ID: 1152751642

View in Genome Browser
Species Human (GRCh38)
Location 17:82065198-82065220
Sequence AGGCGGGGGTCGGTGCAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 324}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152751634_1152751642 4 Left 1152751634 17:82065171-82065193 CCGTTGGGTCACACGCGGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1152751642 17:82065198-82065220 AGGCGGGGGTCGGTGCAGGCTGG 0: 1
1: 0
2: 4
3: 36
4: 324
1152751623_1152751642 29 Left 1152751623 17:82065146-82065168 CCCTTCTAAGGCCGCTCCAGTAC 0: 1
1: 0
2: 0
3: 5
4: 41
Right 1152751642 17:82065198-82065220 AGGCGGGGGTCGGTGCAGGCTGG 0: 1
1: 0
2: 4
3: 36
4: 324
1152751624_1152751642 28 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751642 17:82065198-82065220 AGGCGGGGGTCGGTGCAGGCTGG 0: 1
1: 0
2: 4
3: 36
4: 324
1152751627_1152751642 18 Left 1152751627 17:82065157-82065179 CCGCTCCAGTACCACCGTTGGGT 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1152751642 17:82065198-82065220 AGGCGGGGGTCGGTGCAGGCTGG 0: 1
1: 0
2: 4
3: 36
4: 324
1152751628_1152751642 13 Left 1152751628 17:82065162-82065184 CCAGTACCACCGTTGGGTCACAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1152751642 17:82065198-82065220 AGGCGGGGGTCGGTGCAGGCTGG 0: 1
1: 0
2: 4
3: 36
4: 324
1152751631_1152751642 7 Left 1152751631 17:82065168-82065190 CCACCGTTGGGTCACACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1152751642 17:82065198-82065220 AGGCGGGGGTCGGTGCAGGCTGG 0: 1
1: 0
2: 4
3: 36
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152751642 Original CRISPR AGGCGGGGGTCGGTGCAGGC TGG Exonic