ID: 1152754931

View in Genome Browser
Species Human (GRCh38)
Location 17:82083255-82083277
Sequence GTTCCATGGGGCCCAGGTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 237}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152754931_1152754939 -6 Left 1152754931 17:82083255-82083277 CCTCCACCTGGGCCCCATGGAAC 0: 1
1: 0
2: 0
3: 25
4: 237
Right 1152754939 17:82083272-82083294 TGGAACACCGTGCACTTGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 98
1152754931_1152754938 -7 Left 1152754931 17:82083255-82083277 CCTCCACCTGGGCCCCATGGAAC 0: 1
1: 0
2: 0
3: 25
4: 237
Right 1152754938 17:82083271-82083293 ATGGAACACCGTGCACTTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 70
1152754931_1152754937 -8 Left 1152754931 17:82083255-82083277 CCTCCACCTGGGCCCCATGGAAC 0: 1
1: 0
2: 0
3: 25
4: 237
Right 1152754937 17:82083270-82083292 CATGGAACACCGTGCACTTGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1152754931_1152754943 20 Left 1152754931 17:82083255-82083277 CCTCCACCTGGGCCCCATGGAAC 0: 1
1: 0
2: 0
3: 25
4: 237
Right 1152754943 17:82083298-82083320 TACCACCCCATCCCGGATGCCGG 0: 1
1: 0
2: 1
3: 10
4: 70
1152754931_1152754941 13 Left 1152754931 17:82083255-82083277 CCTCCACCTGGGCCCCATGGAAC 0: 1
1: 0
2: 0
3: 25
4: 237
Right 1152754941 17:82083291-82083313 GGGGCCGTACCACCCCATCCCGG 0: 1
1: 0
2: 1
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152754931 Original CRISPR GTTCCATGGGGCCCAGGTGG AGG (reversed) Exonic
900097440 1:945733-945755 GCCACATGGGGCCCTGGTGGTGG - Intronic
900517978 1:3092177-3092199 GTGCCTGGGGCCCCAGGTGGTGG + Intronic
900598343 1:3492643-3492665 GCTACATGGGGCCCACGTGCCGG - Exonic
900918287 1:5653385-5653407 GTAACATGGGGGCTAGGTGGCGG + Intergenic
900963347 1:5939904-5939926 GTGCCCTGGGGTCCTGGTGGGGG - Intronic
902716932 1:18279528-18279550 GTTAAATGGGGCCCAGGGGATGG - Intronic
904339947 1:29828193-29828215 GTTCCAGGGGGCAGGGGTGGGGG + Intergenic
907665992 1:56434374-56434396 ATTCCATGGGGCCAAGGATGGGG - Intergenic
910475077 1:87597689-87597711 TTTCCATGGGCCCCAGATGGAGG - Intergenic
910664455 1:89709486-89709508 GTACCAGGGTGCCCAGGTGAAGG - Intronic
910845667 1:91602459-91602481 GGTCCAGATGGCCCAGGTGGCGG + Intergenic
912022465 1:105122358-105122380 GTTCCATGTGGCTCACATGGAGG - Intergenic
912831273 1:112956093-112956115 GTTCCACGGGGCCCAGGGTCCGG + Intronic
914878947 1:151532953-151532975 GGTCCCTGGGGCCCAGGTTTAGG + Intronic
916128142 1:161589373-161589395 GTTCCCTGGGGCCCTTGTGGTGG + Intronic
919854507 1:201696089-201696111 GATACATGGGGGCCAGGTAGTGG + Intronic
919872466 1:201832650-201832672 GTTCCATGGGGCCCAGGATCAGG + Intronic
920002870 1:202811431-202811453 GTTGCACGGCGCCCAGGGGGAGG - Intergenic
920205882 1:204291761-204291783 GTTGCCTGGGGCCAGGGTGGAGG + Intronic
920827303 1:209434024-209434046 GTGCCACCTGGCCCAGGTGGAGG + Intergenic
921390451 1:214608863-214608885 GTTGGCTGGGGCCCCGGTGGGGG - Intronic
922093380 1:222419496-222419518 GTTCCTTGGGGCCCAGGATGGGG + Intergenic
922773796 1:228205848-228205870 GTTCAAAGGGGTACAGGTGGAGG - Intronic
923679018 1:236104127-236104149 CTTCCATGGGGGCCAGTGGGAGG - Intergenic
923682537 1:236129629-236129651 GTTCCTTGGGCCCCAAGTGCTGG + Intergenic
924515433 1:244761565-244761587 GTTGCATGAGTCCCACGTGGTGG + Intergenic
1063160092 10:3412700-3412722 GCCCCGTGGGGCCCAGCTGGGGG + Intergenic
1067683159 10:48452630-48452652 GTTCCATGGGCCCTATGAGGTGG + Intronic
1069775428 10:70924454-70924476 GGTGGATGGGGCCCAGGTAGTGG - Intergenic
1069788502 10:71004818-71004840 GATCCTAGGGTCCCAGGTGGAGG + Intergenic
1071248512 10:83791192-83791214 GGTCCATGGGGTTCAGGTGCTGG + Intergenic
1075115928 10:119627256-119627278 TCTCCATGGGCCCCAGGTAGAGG - Intergenic
1075342827 10:121661168-121661190 GTGCCGTGGGGCTCAGATGGTGG + Intergenic
1075967887 10:126628550-126628572 GTTGAATGGAGCCCAGGGGGAGG + Intronic
1076750481 10:132539641-132539663 GCTCCAAGTGGCCCAGATGGAGG + Intronic
1076786847 10:132754167-132754189 GGACCATGGCGGCCAGGTGGCGG - Intronic
1077139752 11:1019038-1019060 GTTCCCTGTGGCCGTGGTGGTGG + Intronic
1077250314 11:1557928-1557950 GGGCCATGGGGGCCAGGTGAGGG + Intronic
1077251786 11:1563983-1564005 GCCCCATGGCCCCCAGGTGGAGG - Exonic
1077623934 11:3753342-3753364 GTTCCAAGAGTCCCAGGTGCTGG + Exonic
1078000839 11:7494211-7494233 GTTCAATGGAGCTCAGGTGAAGG + Intronic
1078093114 11:8279851-8279873 GTCCCATGGGGCACAGGTTTGGG - Intergenic
1078190447 11:9089680-9089702 GTGCCTTGGGGACCATGTGGGGG - Intronic
1078608141 11:12795637-12795659 GGTCCATGGACCACAGGTGGAGG - Intronic
1078690930 11:13579736-13579758 TATCCATGGGGCCGTGGTGGCGG + Intergenic
1079972989 11:27059180-27059202 GCTCCAAGGGGCCCAGGTACAGG + Intronic
1080976808 11:37352681-37352703 GCTTCATGGTGTCCAGGTGGGGG - Intergenic
1083581930 11:63830510-63830532 CTTCCATGGGATCCAGGTGTGGG + Intergenic
1083886882 11:65577290-65577312 GGACCATGGGGTCCAGGGGGAGG + Intronic
1083923205 11:65791411-65791433 GGTCAGTGGGGCCCAGGAGGGGG + Intronic
1084446066 11:69204411-69204433 GTGTCATGGGGCCCCGTTGGGGG + Intergenic
1084789236 11:71463021-71463043 GTTCCACCTGTCCCAGGTGGTGG + Intronic
1088746297 11:112807716-112807738 GTTCCATCAGGCCCAGATGGGGG + Intergenic
1089088083 11:115841007-115841029 GATCCATGGAGTCCAGGAGGTGG - Intergenic
1090236084 11:125148467-125148489 GTACCAAGGGACCCAGGTTGAGG + Intergenic
1090457425 11:126862075-126862097 GTTCCATGCTGTCCAGGTGATGG + Intronic
1091150255 11:133321797-133321819 ATTCCGTGGGTTCCAGGTGGTGG + Intronic
1091299417 11:134497997-134498019 GTTCCTTGGTGCCTGGGTGGAGG + Intergenic
1094617136 12:32046140-32046162 GTTGCATGGGGTTCAGGTTGGGG + Intergenic
1096586947 12:52629058-52629080 GGTCCTTGGGGGCCAGCTGGAGG - Intergenic
1097042710 12:56165314-56165336 TTACCATGGGGTCCAGGGGGGGG + Exonic
1100195961 12:92244856-92244878 GTTCCCTGGGTCTCAGGTGAAGG + Intergenic
1100289369 12:93199243-93199265 GAGCCATGGTGCCCAGCTGGAGG - Intergenic
1100445527 12:94656427-94656449 GTTCCATGTGGCACTGGGGGGGG + Intergenic
1101236804 12:102797882-102797904 GTTCCTGGGTGCCCAGGAGGTGG + Intergenic
1101344992 12:103878632-103878654 GGACTTTGGGGCCCAGGTGGGGG - Intergenic
1105443763 13:20435747-20435769 GTCACATGGGGCCCGGGCGGCGG - Intronic
1106407387 13:29485750-29485772 GTCCCATGAGTCCCAGGAGGTGG - Intronic
1112122721 13:96430962-96430984 GTACCCTGGGGCCAAGGTGCGGG + Intronic
1112183165 13:97104797-97104819 GTTCCCTGGAGCTCAGGAGGTGG + Intergenic
1114994296 14:28328511-28328533 TTTCCATGTGGCACAGCTGGGGG + Intergenic
1118215821 14:63807739-63807761 GATCCATTGAGCCCAGGAGGTGG - Intergenic
1118614637 14:67566994-67567016 GGTCCTTGGGGCCTAGCTGGGGG - Intronic
1118708104 14:68498675-68498697 ATTGCATGGGGCTCTGGTGGTGG - Intronic
1118944436 14:70371273-70371295 GTTTCATGCGGCCTAGGAGGAGG - Exonic
1119159052 14:72438083-72438105 GTTCCAGGAGGGCCTGGTGGAGG + Intronic
1122805408 14:104253904-104253926 GTGAGATGGGGTCCAGGTGGAGG + Intergenic
1122828297 14:104382995-104383017 GATCCTGGGGGCCCAGGTTGTGG + Intergenic
1122920387 14:104877523-104877545 GGCTCATGGGGCCAAGGTGGGGG + Intronic
1123125334 14:105941879-105941901 GTCCCATGGGGCCCACATCGTGG + Intergenic
1124624214 15:31298980-31299002 GACCCATGAGGCCCAGGTGGAGG + Intergenic
1126154518 15:45553014-45553036 GTTCCATGAGGCATTGGTGGAGG - Intergenic
1126636445 15:50784821-50784843 GTTTGATGGGTCCCAGGTGCAGG + Intergenic
1127647625 15:60974147-60974169 GTTCCACGGGGGCCAGGGTGGGG - Intronic
1128147014 15:65337491-65337513 GTACCTTGGGGCCCTGGGGGTGG + Intronic
1129265244 15:74389837-74389859 GCTCCATGGTGCCCTGGTGACGG - Intergenic
1129890531 15:79068907-79068929 GTTCCCTGGGGCCCAGGGAGAGG - Intronic
1130977343 15:88787631-88787653 GTTGCCTGGGGCCAAGGAGGTGG + Intergenic
1131965931 15:97842298-97842320 TTTTTATGGGGCCCAAGTGGGGG - Intergenic
1132403637 15:101529099-101529121 GTTCCATGAGGCCTGGGTGGAGG - Intergenic
1133524436 16:6590620-6590642 GCTTCATGGGGCCTAGCTGGAGG + Intronic
1134137932 16:11692031-11692053 CTGTCATGGGGACCAGGTGGTGG - Exonic
1135335836 16:21600008-21600030 TTTCCAAGGGGCCGAGGCGGAGG - Intronic
1135487731 16:22880603-22880625 GTGCCATGTGGCCCAGGCTGAGG + Intronic
1136567723 16:31080149-31080171 GTTCCATGTGGACCCGCTGGTGG - Exonic
1139595907 16:67958131-67958153 GTTCCCTGGGGCCCCACTGGGGG - Intronic
1142185305 16:88692074-88692096 GTGCCATGGGGCAGGGGTGGGGG - Intergenic
1142259533 16:89036316-89036338 GCTCCATGAGGGCCAGGTGGAGG + Intergenic
1142478001 17:201060-201082 GGTCCATCTGACCCAGGTGGTGG + Intergenic
1143100696 17:4503205-4503227 GTCCCAGGAGCCCCAGGTGGAGG + Intronic
1144133290 17:12268380-12268402 GTGTCATGGGGCCCTGGAGGGGG + Intergenic
1144762961 17:17717670-17717692 GGTTCAGAGGGCCCAGGTGGGGG - Intronic
1146124259 17:30219429-30219451 GTTCCAAGGGTCCCAGGTACTGG - Intronic
1147358730 17:39918059-39918081 GTTCCAAGGGGCCCAAGGGATGG + Intronic
1147436830 17:40421523-40421545 GTTCCAGGGGGCTGTGGTGGGGG + Intergenic
1148186599 17:45649062-45649084 GTTCCTAGGGGGCCAAGTGGGGG - Intergenic
1149657744 17:58319189-58319211 GATCCAAGGGGCCCGGGTGCAGG + Exonic
1150416555 17:64993484-64993506 GTGCCAAGGGGCACACGTGGAGG + Intergenic
1151310208 17:73288136-73288158 GTGCCGTGGGGGGCAGGTGGTGG - Intronic
1151722173 17:75863460-75863482 ATTCCATGGTGCCCAGGGGATGG - Intergenic
1151830229 17:76545042-76545064 GTGCCATGTGGGCCGGGTGGGGG + Intronic
1152036809 17:77878577-77878599 GTTGCTTGGGGCCAAGATGGGGG - Intergenic
1152426689 17:80221886-80221908 GTTCCTTGGGGCCCAGGGGCTGG - Intronic
1152754931 17:82083255-82083277 GTTCCATGGGGCCCAGGTGGAGG - Exonic
1157046536 18:44107097-44107119 TCTCCATGGGACCCAGGTGAAGG + Intergenic
1157398673 18:47367403-47367425 GATCCTTGGGCCCCTGGTGGGGG + Intergenic
1158332737 18:56380661-56380683 GTACCATGGGGCCTGAGTGGAGG - Intergenic
1158865096 18:61631004-61631026 TTTCCAAGGGGCAGAGGTGGGGG + Intergenic
1159105258 18:63996999-63997021 GATCCATGGGGTCCAGGGGAAGG - Intronic
1159530206 18:69646584-69646606 CTTCCATGGTGCCCATTTGGTGG + Intronic
1160532461 18:79573540-79573562 CCTGCATCGGGCCCAGGTGGAGG - Intergenic
1161152281 19:2716232-2716254 GCTCTCTGGGGCACAGGTGGTGG + Exonic
1161171634 19:2815190-2815212 CTTCGCTGGGGACCAGGTGGAGG - Exonic
1161813359 19:6483656-6483678 GATCCCTTGAGCCCAGGTGGTGG + Intergenic
1162392486 19:10397938-10397960 ATCCGATGGGGCCCAGATGGAGG - Intronic
1163511711 19:17739468-17739490 ATCCCATGGGGCCCTGGGGGAGG + Intergenic
1163843731 19:19627447-19627469 GCTCCATGGGGCTGGGGTGGAGG + Exonic
1165406292 19:35633154-35633176 GGTCCAGGGGGCCCAGGCAGAGG - Exonic
1166375845 19:42326306-42326328 GTCCCCTGGGGCCCGGGCGGGGG + Exonic
1167338460 19:48900800-48900822 GTTCCTCGGGGCCCAGAGGGAGG - Exonic
1167498884 19:49834705-49834727 GGTCCATGAGGAGCAGGTGGTGG + Intronic
1167574212 19:50309928-50309950 GTTGCAGGGGACCCAGGTGGGGG - Exonic
926009987 2:9400110-9400132 GGTCCATGGGGGCAATGTGGGGG + Intronic
926125246 2:10267876-10267898 GTTCCCTGAGGAGCAGGTGGAGG - Intergenic
926314113 2:11697036-11697058 CTTCCCTGGGCCACAGGTGGGGG - Intronic
929171670 2:38938311-38938333 GATCCATTGGGCCCAGGAGTTGG + Intronic
929583808 2:43101262-43101284 TTTCCATGGGGCCCTGGAGGAGG + Intergenic
931365951 2:61619159-61619181 GTTCTATGGGGTGGAGGTGGGGG + Intergenic
932344874 2:70988881-70988903 TTTGTAAGGGGCCCAGGTGGGGG - Intronic
932448190 2:71793482-71793504 GCTCCCTGGGGCCCTGATGGAGG + Intergenic
932758889 2:74426720-74426742 GCCCCAGGGGGCCCAGGTGAGGG - Intronic
932776050 2:74529074-74529096 GTTCCCTGGGGCCCAGCTGAAGG - Intronic
934758335 2:96839738-96839760 GCTCTATGGGGCCGAGCTGGGGG - Exonic
936117407 2:109713082-109713104 GTTTCAAGAGACCCAGGTGGAGG - Intergenic
937008017 2:118535748-118535770 GCTCCATGGGCGCCAGGTGGAGG + Intergenic
938195851 2:129327286-129327308 ATTCCATGGGAACCAAGTGGAGG - Intergenic
942674377 2:178412210-178412232 TTGGCATGGGGCCCAGGTGATGG + Intergenic
946346726 2:219117027-219117049 GTTGGATGGAGCCCAGGTTGTGG - Intronic
946404354 2:219484549-219484571 CTTCCGTGGGGCCGAGGAGGAGG + Exonic
946493159 2:220169963-220169985 ATTGCATGGGGTACAGGTGGAGG + Intergenic
948108439 2:235434423-235434445 GATCACTGGAGCCCAGGTGGTGG - Intergenic
948372984 2:237502414-237502436 GCTCCAGGGTGCCCAGGAGGAGG - Intronic
948996631 2:241583719-241583741 GATCCCTGGAGCCCGGGTGGTGG - Intergenic
1170662722 20:18358653-18358675 GAAGCATGGGGCACAGGTGGAGG + Intergenic
1171016488 20:21546634-21546656 GTTCCAAGGGGCAAAGGTGAAGG + Intergenic
1171411307 20:24950350-24950372 GGCCAAAGGGGCCCAGGTGGGGG + Intronic
1171464796 20:25319919-25319941 GTTCCGTGGGGACCAAGTGTGGG - Intronic
1172022296 20:31923499-31923521 GTGACATGGGGGCCAGGAGGTGG + Intronic
1173293230 20:41732737-41732759 GTGTCATGGGGCTCAGATGGGGG + Intergenic
1174349044 20:49954028-49954050 GCACCATGAGGCCCAGCTGGTGG - Intergenic
1175497661 20:59425938-59425960 GTTCTGAGGGCCCCAGGTGGTGG + Intergenic
1176706583 21:10123051-10123073 GGTCCATGGGGCCCAGGGCAGGG - Intergenic
1178373594 21:32048506-32048528 CTTCCTTGGGGCCTAGGTGGGGG - Intergenic
1179884460 21:44307610-44307632 GTTCCCTGGGGCCAAGATGGGGG - Intronic
1180043325 21:45291700-45291722 GTGCCATGGGTCCCCGGTGGGGG - Intergenic
1180611421 22:17100591-17100613 GTTCTGTGGGTCCCAGGTGCTGG - Intronic
1180911852 22:19456168-19456190 GCTCCATGGGAAACAGGTGGAGG - Intronic
1181422635 22:22812210-22812232 TATCAGTGGGGCCCAGGTGGAGG + Intronic
1181461052 22:23086230-23086252 GTCCCGTGGGGCCCAGTTGGAGG + Intronic
1181532881 22:23527048-23527070 TCTCCATGGTGCCCAGATGGAGG - Intergenic
1181575543 22:23792231-23792253 CTTCCATGCAGCCCAAGTGGCGG + Intronic
1182281342 22:29219323-29219345 GCTCCAGGGGGCCCATGGGGAGG - Intronic
1183507768 22:38219004-38219026 GGTCCATGGGGCCCACATGCTGG - Intergenic
1184533434 22:45071084-45071106 GGTGAATGGGGCCCAGGAGGTGG - Intergenic
1184587448 22:45457496-45457518 GTGCCATGGGGATCGGGTGGGGG - Intergenic
1184676464 22:46045734-46045756 GTTCCTTGGGGAGCAGGTGAGGG + Intergenic
1184833051 22:47002753-47002775 GTTCCCTGGGGCCCCGGTTCTGG + Intronic
1184880454 22:47300961-47300983 CTTCCATGTGGCCCAGATGAGGG - Intergenic
949890761 3:8732306-8732328 GCTCCCTGGTGGCCAGGTGGAGG - Intronic
951462212 3:22963524-22963546 ATTCCAAGGGGCCCAGTTTGCGG + Intergenic
951553846 3:23901263-23901285 GATCCCTTGAGCCCAGGTGGCGG - Intronic
952142307 3:30493625-30493647 TTTCCCTGGAGCCCAGGTGGCGG - Intergenic
954159263 3:48708782-48708804 GTTCCATAGGGCCCGTGTGGTGG + Intronic
954403080 3:50329482-50329504 GCTCCCTGGGGCTCAGGTTGTGG - Intergenic
955905501 3:63803609-63803631 GTGCCATGGGGACCATGTAGAGG + Intergenic
956064983 3:65388620-65388642 TTACCATGGGGGCCAGGGGGAGG + Intronic
957036136 3:75294751-75294773 GTTGCTTGGGGCCAAGGTAGGGG + Intergenic
959609387 3:108277086-108277108 GTACAATGGGGACCGGGTGGTGG - Intergenic
962996297 3:140632318-140632340 GTGCCGTGGGGCCCAAGTGGGGG - Intergenic
964541108 3:157780963-157780985 GTTCCATGGGTCTCAGCTGTGGG - Intergenic
967471798 3:189870519-189870541 TATCCATGGGGGCCAGATGGGGG + Intronic
968516795 4:1018876-1018898 GGTCCGGGGAGCCCAGGTGGGGG + Intronic
968878711 4:3287864-3287886 GTCCCACGGGGCCTGGGTGGGGG + Intergenic
968962573 4:3752965-3752987 GTTCCAGGGGACAGAGGTGGAGG - Intergenic
969095628 4:4730239-4730261 GGTCCATGGGGCTCAGGGTGGGG + Intergenic
969415096 4:7052882-7052904 GATTCCTGGGCCCCAGGTGGCGG + Intronic
969437941 4:7199367-7199389 GTCACATGGGCCACAGGTGGAGG + Intronic
969519920 4:7670740-7670762 CTGCCATGGGGCCGGGGTGGGGG - Intronic
978620487 4:110631579-110631601 GTTCTATGGGGCGGAGGGGGGGG - Intronic
997439385 5:133898683-133898705 GCTACATGAGGCCCTGGTGGAGG - Intergenic
998193355 5:140044921-140044943 TTTCCATGTGGTCAAGGTGGAGG - Intergenic
998389142 5:141775857-141775879 TTTCCATGGACCCCGGGTGGGGG - Intergenic
999268178 5:150280579-150280601 CTTCCATGGAGCCCTGGGGGCGG - Intronic
1001630087 5:173168527-173168549 CTTCCCTGGGGCCCTGCTGGAGG + Intergenic
1002043621 5:176530543-176530565 CTGCCCTGGAGCCCAGGTGGGGG + Intronic
1002178897 5:177419509-177419531 GATCGATTGGGCCCAGGAGGTGG + Intronic
1005410339 6:25538829-25538851 TTTCCATGGCGTCCAGGGGGTGG - Intronic
1005803666 6:29452302-29452324 GTTTCAAGGGGCACAGGTGCAGG - Intronic
1006602177 6:35233381-35233403 AGTGCATGGGGCCCAGGTGCTGG + Intronic
1006638820 6:35478412-35478434 GGTACATGGGTCCCAGGAGGTGG - Exonic
1008696884 6:54048680-54048702 GTTCCATAGGGCACAGATGAAGG + Intronic
1018328688 6:162704179-162704201 GTCCCCTGCTGCCCAGGTGGAGG - Intronic
1018434994 6:163751533-163751555 TTTCCACGGGACCCAGGTGTCGG + Intergenic
1018831800 6:167448951-167448973 TTTCCATGGGGTCCAGATAGGGG + Intergenic
1018966635 6:168495237-168495259 GCTCCTTGTGGCCCAGGTGTAGG + Intronic
1019217532 6:170453444-170453466 CTTCCAAGGGGCCCGAGTGGCGG + Intergenic
1019436568 7:1025308-1025330 GTTCCAAGGATCCCAAGTGGGGG + Intronic
1020292321 7:6731189-6731211 GATCAATGGAGCCCAGGAGGTGG + Intergenic
1020332974 7:7039103-7039125 CTTCCATGAGGACCAGGTAGTGG - Intergenic
1021797470 7:24271359-24271381 TTTCCATGGTGCCATGGTGGCGG + Intergenic
1023972358 7:45000441-45000463 GTTCCTTGGGGCCCGGGGGGGGG + Intronic
1026066938 7:67082956-67082978 GCTGCTTGGGTCCCAGGTGGAGG + Intronic
1026484070 7:70802527-70802549 GGTCCCTGGGGTCTAGGTGGTGG - Intergenic
1026709987 7:72729384-72729406 GCTGCTTGGGTCCCAGGTGGAGG - Intronic
1028225778 7:88250706-88250728 GATCCCTTGGGCCCAGGAGGTGG + Intergenic
1029449776 7:100634287-100634309 TCTCCATGAGGCCCACGTGGAGG - Intronic
1029745439 7:102513465-102513487 GTTCCAAGGGTCTCAGGTGTTGG + Intronic
1029763378 7:102612444-102612466 GTTCCAAGGGTCTCAGGTGTTGG + Intronic
1033062527 7:138122333-138122355 GCTCCATGGGGCCCTGGCGGAGG + Intergenic
1033246440 7:139720355-139720377 GATCCATGGGCCCAGGGTGGAGG - Intronic
1034433548 7:151052457-151052479 GTTACCTGGGGCCCAGGCTGAGG - Exonic
1035245346 7:157559375-157559397 GTTTCCAGGGGCCCATGTGGAGG - Intronic
1035396872 7:158540499-158540521 CTCCCATGGAGCACAGGTGGGGG - Intronic
1037944073 8:22975480-22975502 GTTTCATGTGGCCCAAGTGCTGG + Intronic
1039079714 8:33722721-33722743 GTTCCAGAGGGCCCAGGTCCTGG + Intergenic
1039895919 8:41716403-41716425 GTCTCATGGGGCCCAGCTGGAGG + Intronic
1042137494 8:65645610-65645632 GATCGCTGGGGCCCAGGAGGTGG - Intronic
1048687003 8:136916185-136916207 GGTCAATAGGGCCCAGGGGGAGG - Intergenic
1049432777 8:142573044-142573066 CTTGCATGGGGCTCAGGTGCTGG + Intergenic
1049551560 8:143262147-143262169 TTGCCCTGGGGCCCAGGTGCAGG + Intronic
1049612752 8:143563008-143563030 CTACCATGGGGCCCAGGAGTTGG + Exonic
1049743846 8:144254734-144254756 GGTCCACGGCACCCAGGTGGCGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1051181785 9:14419217-14419239 TTTCCAAGGGGCCCATGTTGAGG - Intergenic
1053107558 9:35424778-35424800 GTTCCATTAAGCCCAGGTGCTGG - Intergenic
1053281939 9:36826140-36826162 GTTCCATGTAGCACAGCTGGGGG - Intergenic
1053643876 9:40110170-40110192 GGTCCATGGGGCCCAGGGCAGGG - Intergenic
1053762276 9:41355319-41355341 GGTCCATGGGGCCCAGGGCAGGG + Intergenic
1054324731 9:63707398-63707420 GGTCCATGGGGCCCAGGGCAGGG - Intergenic
1055485531 9:76753114-76753136 GATCCATTGAGCCCAGGAGGTGG - Intronic
1056658935 9:88530847-88530869 GTCACTGGGGGCCCAGGTGGTGG - Intergenic
1057020111 9:91690788-91690810 GTTACAGTGGGCCCTGGTGGAGG + Intronic
1057748759 9:97773136-97773158 GTTTCATTTGGGCCAGGTGGTGG - Intergenic
1058526509 9:105864530-105864552 TCTCCACGTGGCCCAGGTGGAGG + Intergenic
1058725229 9:107796826-107796848 ATTCCAAGGGACCCAGGTGGAGG - Intergenic
1059728723 9:117035110-117035132 GTTCCAAGCTGCCCAGGTGCTGG - Intronic
1061346244 9:130028011-130028033 TTTCCGGGAGGCCCAGGTGGGGG - Intronic
1062141025 9:134959302-134959324 GTGCCTCGGGGCCCAGGTAGTGG + Intergenic
1062624124 9:137435332-137435354 GTCTCCTGGGCCCCAGGTGGAGG - Exonic
1185503186 X:614343-614365 GCTACAGGGGTCCCAGGTGGGGG - Intergenic
1186434014 X:9528109-9528131 GTTTCATGGGGACCAGGTTTCGG - Intronic
1190303258 X:49068251-49068273 AGTCCATGGGGTCCTGGTGGAGG + Intronic
1190825851 X:54017358-54017380 GATCCCTGGAGCCCAGGAGGAGG + Intronic