ID: 1152757083

View in Genome Browser
Species Human (GRCh38)
Location 17:82091552-82091574
Sequence CGTTGCCGCCACGGACGGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152757077_1152757083 -4 Left 1152757077 17:82091533-82091555 CCAAAGGAGTTGATGCCCACGTT 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1152757083 17:82091552-82091574 CGTTGCCGCCACGGACGGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 33
1152757075_1152757083 3 Left 1152757075 17:82091526-82091548 CCCGAAGCCAAAGGAGTTGATGC 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1152757083 17:82091552-82091574 CGTTGCCGCCACGGACGGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 33
1152757070_1152757083 30 Left 1152757070 17:82091499-82091521 CCTCAGGATGATGTGCACGTTGG 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152757083 17:82091552-82091574 CGTTGCCGCCACGGACGGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 33
1152757076_1152757083 2 Left 1152757076 17:82091527-82091549 CCGAAGCCAAAGGAGTTGATGCC 0: 1
1: 0
2: 2
3: 6
4: 141
Right 1152757083 17:82091552-82091574 CGTTGCCGCCACGGACGGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 33
1152757073_1152757083 5 Left 1152757073 17:82091524-82091546 CCCCCGAAGCCAAAGGAGTTGAT 0: 1
1: 0
2: 0
3: 3
4: 103
Right 1152757083 17:82091552-82091574 CGTTGCCGCCACGGACGGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 33
1152757074_1152757083 4 Left 1152757074 17:82091525-82091547 CCCCGAAGCCAAAGGAGTTGATG 0: 1
1: 0
2: 1
3: 11
4: 103
Right 1152757083 17:82091552-82091574 CGTTGCCGCCACGGACGGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152757083 Original CRISPR CGTTGCCGCCACGGACGGGC AGG Exonic
906204573 1:43979855-43979877 CGTGGCACCCGCGGACGGGCAGG - Intronic
908555205 1:65250601-65250623 CGTAGCTGCCAGGGAGGGGCAGG - Intronic
922536268 1:226383091-226383113 CGTGGCCGCCACGGAGGCGCTGG + Exonic
1076724231 10:132405891-132405913 CGGTGCCGCCCCTGACGGTCAGG + Exonic
1077133482 11:986794-986816 GGTTGCAGGCACGGACGAGCAGG - Exonic
1081818209 11:45965443-45965465 CATTGACGACACGGACGGGGTGG + Exonic
1087169642 11:95037802-95037824 CGAGGCCGCCATGGACGGGGCGG + Intergenic
1087172778 11:95067439-95067461 CGAGGCCGCCATGGACGGGGCGG + Exonic
1202859581 14_GL000225v1_random:72847-72869 CATTGCCGCCAGGGAAGAGCTGG - Intergenic
1123991731 15:25688422-25688444 CGTTTCCTCCATGGACAGGCAGG + Intronic
1132113043 15:99116123-99116145 CCTTGCTGCCACTGAGGGGCTGG + Intronic
1132850002 16:2020628-2020650 CGGAGGCGCCACGGGCGGGCGGG - Exonic
1139637082 16:68264391-68264413 CGTGGCCGCCACGGCCTGGCCGG - Intergenic
1147672350 17:42184003-42184025 CTTTGCCACCCCGGATGGGCAGG + Intergenic
1152757083 17:82091552-82091574 CGTTGCCGCCACGGACGGGCAGG + Exonic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
925998057 2:9307858-9307880 CTGTGCTGCCAGGGACGGGCTGG + Intronic
1169065684 20:2693164-2693186 CGCTGGCGCCGCGGGCGGGCGGG + Intronic
1179627052 21:42654498-42654520 CGTGGCCCCCTCTGACGGGCAGG + Intronic
1179973399 21:44849004-44849026 GGTTTCCGCCGCAGACGGGCTGG + Intergenic
1180060492 21:45382567-45382589 CCTTGCAGCCAGGGATGGGCAGG + Intergenic
1184698041 22:46150612-46150634 CGTTCGCCCCACGGACCGGCAGG + Intronic
950289398 3:11771312-11771334 TGTGGCCTCCAGGGACGGGCTGG + Intergenic
954110105 3:48429002-48429024 CGTCGCCGCCGGGGACCGGCCGG - Intronic
954408681 3:50359528-50359550 CGCTGCCGCCGGGGACGCGCAGG - Exonic
967168628 3:186806452-186806474 AGTTCCCGCCACGGAACGGCGGG + Exonic
970332942 4:15003490-15003512 CGGCGCCGCCACGGAGGCGCGGG + Exonic
986206188 5:5627459-5627481 GGCTGCAGCCACGGAGGGGCAGG + Intergenic
996738475 5:126777889-126777911 CGTTAGCGCCAAGGAGGGGCGGG + Intronic
999790867 5:154938287-154938309 CGTTCCCGCTACCGCCGGGCTGG + Intergenic
1019995002 7:4718283-4718305 CGTGGCCGCCACGGTGGGGATGG - Intronic
1041552684 8:59119264-59119286 CGCTGCCGCCGCCGCCGGGCAGG + Intergenic
1044609883 8:94080751-94080773 CGGTGCAGCCTCGGAAGGGCAGG + Intergenic
1049105349 8:140609110-140609132 CGTGGCCCCCAGGGAAGGGCTGG - Intronic
1049784744 8:144444827-144444849 CGCTGCGACCCCGGACGGGCTGG - Intergenic
1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG + Exonic