ID: 1152757427

View in Genome Browser
Species Human (GRCh38)
Location 17:82092812-82092834
Sequence CACTGAGCCGAGCCCTCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152757427_1152757428 -5 Left 1152757427 17:82092812-82092834 CCTGCGGAGGGCTCGGCTCAGTG 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1152757428 17:82092830-82092852 CAGTGCTGCAGCCCCAGCCCCGG 0: 1
1: 0
2: 4
3: 96
4: 708
1152757427_1152757441 29 Left 1152757427 17:82092812-82092834 CCTGCGGAGGGCTCGGCTCAGTG 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1152757441 17:82092864-82092886 CCCCCAGCACCCCGGAACCCCGG 0: 1
1: 0
2: 0
3: 39
4: 391
1152757427_1152757437 21 Left 1152757427 17:82092812-82092834 CCTGCGGAGGGCTCGGCTCAGTG 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1152757437 17:82092856-82092878 CCACCTGCCCCCCAGCACCCCGG 0: 1
1: 0
2: 9
3: 109
4: 731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152757427 Original CRISPR CACTGAGCCGAGCCCTCCGC AGG (reversed) Exonic
900119291 1:1041716-1041738 CACTGGCCGGAGCCCTCCCCCGG - Intronic
900119311 1:1041763-1041785 CACTGGCCGGAGCCCTCCCCCGG - Intronic
900140442 1:1137377-1137399 CACTCAGCCCCGCCCCCCGCAGG + Intergenic
901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG + Intronic
905548866 1:38819993-38820015 CACTCAGCTTAGGCCTCCGCGGG - Intergenic
905912141 1:41662341-41662363 CCCGGAGCCGCGCCCGCCGCCGG - Intronic
909513562 1:76482513-76482535 CACTGGGCCAAGTCCTCCACAGG + Intronic
909609448 1:77537197-77537219 GACTCAGCCGAGTCCTCCTCAGG - Intronic
914247826 1:145898977-145898999 CACTGAGCCGGAGCCTCCGAGGG + Exonic
920214171 1:204350479-204350501 CTCTGAGCCCAGCCCTGCGGAGG - Intronic
921175165 1:212586947-212586969 CGCTGGGCTGGGCCCTCCGCAGG + Intronic
923511756 1:234659252-234659274 CACAGAGCCGAGCTGTCCCCAGG + Intergenic
924474491 1:244371292-244371314 CTCTGAGCAGAGCCCTGAGCTGG + Intronic
924677905 1:246199299-246199321 CACTGAGCTGAGCACACCCCAGG + Intronic
924721491 1:246627208-246627230 CACTGTGCAAAGCCCTCCGATGG + Intronic
1063382516 10:5594784-5594806 CCCTGAGCCCAGCCCTGCTCAGG - Intergenic
1064031627 10:11886691-11886713 CGCTGAGCCGACCCCTGCACAGG + Intergenic
1064478610 10:15718792-15718814 CACTGCGCAGACCCCTCCGCGGG + Exonic
1071568047 10:86681588-86681610 CTCTGACCCTGGCCCTCCGCGGG + Exonic
1072428199 10:95348017-95348039 CACTGTGCCTAGCCTTCCACAGG + Intronic
1074786781 10:116848954-116848976 CTCTGAGCCGAGCCGTGTGCTGG - Intergenic
1075117191 10:119636852-119636874 CACTGTGCCCAGCCCTCTTCAGG - Intergenic
1075700253 10:124464666-124464688 CACTGCCCAGAGCCCTCTGCTGG - Intronic
1076451164 10:130557872-130557894 CATGGAGCAGAGCCCTCCCCCGG - Intergenic
1076578625 10:131491384-131491406 CCCTGAGCCCAGCACTCCGCAGG - Intergenic
1076704402 10:132293442-132293464 CAGTGAGCCAAGCCCTCCCTTGG + Intronic
1076754950 10:132564506-132564528 CAGTGAGCTGAGCCCTGGGCCGG - Intronic
1077019162 11:409877-409899 CTCTGAGCCGGGGCCTCCTCGGG + Exonic
1077442743 11:2576247-2576269 CACTGAGCCGGCGCCTTCGCTGG - Intronic
1078904470 11:15671323-15671345 CACTGAGCCCAGGCTTCAGCAGG + Intergenic
1080503549 11:32892459-32892481 CCCTGAGCAGCGCCCTACGCTGG + Intergenic
1080627583 11:34044512-34044534 CACTGAGCCCAGCCATCTTCTGG + Intergenic
1081578431 11:44334422-44334444 CACTGGGCCGATACCTCCCCTGG - Intergenic
1084458452 11:69282830-69282852 CACTGTGCTGAGCCCTGGGCTGG - Intergenic
1084474410 11:69380699-69380721 CAGGGAGCAGAGGCCTCCGCTGG - Intergenic
1084936068 11:72587377-72587399 CACTGAGCTGAGCCCCACCCTGG + Intronic
1087124926 11:94615337-94615359 CACTGAGCTGTGCCCTCCGTAGG + Intronic
1088333651 11:108679143-108679165 CACTGTGCCCAGCCTTCCCCTGG + Intronic
1091789771 12:3265089-3265111 CCCTGAGCCCAGCACTGCGCTGG - Intronic
1091833077 12:3564078-3564100 AGGTGAGCCGGGCCCTCCGCAGG + Intronic
1103563802 12:121805448-121805470 CTCGGAGCCGAGCCCCCCGCGGG - Intronic
1113901317 13:113799872-113799894 CACAGAGCTGTGCCCTCCGACGG - Intronic
1114280213 14:21187268-21187290 CACCGCGCCCAGCCCTCCCCTGG - Intergenic
1119608629 14:76043006-76043028 CACAGAGCAGAGCCCTGGGCTGG + Intronic
1121048695 14:90805830-90805852 CATTGAGCTGTGCCCGCCGCAGG - Intronic
1122720097 14:103716728-103716750 CCCTGAGCCAGGCCATCCGCTGG + Intronic
1122815048 14:104308067-104308089 CACTGAGCCGAGCTCTCCCCCGG + Intergenic
1122884618 14:104705505-104705527 CAATGAGCACAGCCCTCCGCAGG - Intronic
1126109563 15:45167490-45167512 CTCTGGGCGGAGCCCTCCGACGG + Exonic
1130335190 15:82952354-82952376 ACCTGACCCGCGCCCTCCGCCGG - Intronic
1132374245 15:101318284-101318306 CGCTGGCCCGAGGCCTCCGCAGG + Intronic
1133116964 16:3582915-3582937 CCCTGACCCCAGCCCTGCGCAGG - Intronic
1133153735 16:3856932-3856954 CACTGAGGCCAGCCCTGCCCTGG - Intronic
1136273049 16:29159632-29159654 CACTGAGCCAGCCCCTCCGATGG - Intergenic
1138282358 16:55781621-55781643 CACTGCCCAGAGCCCACCGCAGG + Intergenic
1138286585 16:55815023-55815045 CACTGCCCAGAGCCCACCGCAGG - Intronic
1141927585 16:87179281-87179303 CACTGACCAGAGCCCACTGCAGG + Intronic
1142076598 16:88121434-88121456 CACTGAGCCAGCCCCTCCGATGG - Intergenic
1143113617 17:4568170-4568192 CACTGTACCCAGCCCTCCCCAGG + Intergenic
1143963954 17:10742663-10742685 CCCTGCGCCGTGCCCTCCACTGG + Intergenic
1147050087 17:37787650-37787672 CACTGAGTCCTGCCCTCCGAGGG - Intergenic
1149767983 17:59295993-59296015 CACTGAGCCGAGCCTTGAGCTGG + Intergenic
1152567860 17:81108141-81108163 CAGGGAGCCGAGGCCCCCGCAGG - Intronic
1152757427 17:82092812-82092834 CACTGAGCCGAGCCCTCCGCAGG - Exonic
1156275691 18:35581393-35581415 CGCTGCGGCGAGCCCACCGCGGG - Intronic
1158373190 18:56832232-56832254 GACTGGGCGGAGCCCACCGCAGG + Intronic
1160750913 19:734075-734097 CACTGTGCCATGCCCTCCCCAGG + Intronic
1161657866 19:5526843-5526865 CACTGTGCCCAGCCCACAGCTGG + Intergenic
1166711755 19:44942191-44942213 CACAGAGCAGGGCCCTCCCCCGG - Intergenic
1167486676 19:49767015-49767037 CAAGGAGCCGAGCCGGCCGCGGG - Intronic
1168121597 19:54255078-54255100 CTCTGAGCTGAGACCTCCCCAGG + Intronic
1168125101 19:54278603-54278625 CTCTGAGCTGAGACCTCCCCAGG + Intronic
926095993 2:10080636-10080658 AACTCAGCCGGGCCCCCCGCAGG - Intronic
926112512 2:10192271-10192293 CACTGAGCAAAGCCTTCCCCAGG + Intronic
926957518 2:18317771-18317793 CACTGCGCCGAGCCGACCACAGG - Intronic
927460336 2:23293140-23293162 CCCAGAGCTGAGCCCTCAGCTGG - Intergenic
930069766 2:47356604-47356626 CACTGAGCCCAGCCCTACTAAGG + Intronic
930116027 2:47718834-47718856 CACCCAGCTGAGCCCTCCGAAGG - Intronic
932419411 2:71592623-71592645 CACTGTGCCAGGCCCTCCCCTGG - Intronic
935503469 2:103870008-103870030 CACTGAGCCCGGCCCGCCTCTGG + Intergenic
935987313 2:108687724-108687746 CACTGTGCCCTGCCCTCAGCTGG + Intergenic
936228644 2:110680334-110680356 CACTGGGCTGAGCCCTCCATAGG - Intergenic
936488455 2:112947673-112947695 CACTGAGCCCTGCCCTGGGCAGG + Intergenic
942144964 2:173017886-173017908 CCCTGAGCCCAGCCCTGAGCAGG + Intronic
948146007 2:235708484-235708506 TACAGAGCCCAGCCCTCTGCAGG - Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1170589313 20:17759360-17759382 CACTGAGCCCAGCCGACGGCAGG + Intergenic
1175581269 20:60101814-60101836 CACTGAACTGAGCCCCCCACAGG - Intergenic
1175776903 20:61659430-61659452 CACTGAGCAGACCCCTCCCCAGG - Intronic
1175821683 20:61913469-61913491 CACTGGGCCAGGCCCTCAGCAGG + Intronic
1175892385 20:62321457-62321479 CACTGACCCCACCCCTCTGCTGG - Intronic
1175892477 20:62321709-62321731 CACTGACCCCACCCCTCTGCTGG - Intronic
1175892492 20:62321743-62321765 CACTGACCCCACCCCTCCACTGG - Intronic
1179534847 21:42044968-42044990 CACTAAGCCCAACCCTCCTCTGG + Intergenic
1179989575 21:44940147-44940169 CCCGGAGGCGACCCCTCCGCCGG + Exonic
1185288243 22:50011773-50011795 CCCTGAGCTGAGCCCTCTGCTGG + Intronic
951510937 3:23501357-23501379 CACTGAGTCGTGCACTCCACTGG + Intronic
953829170 3:46280670-46280692 CACTGAGCCTAGACCTCCCCAGG + Intergenic
954409660 3:50364952-50364974 CACTGCTCCGGGCCGTCCGCTGG + Exonic
955693082 3:61608907-61608929 CACTGAGCCCAGACCTCAGATGG - Intronic
962887023 3:139637239-139637261 CACAGAGCAGAGCCCTCAACTGG - Intronic
968698206 4:2042714-2042736 CCCTGACCCGCGCCCCCCGCAGG + Exonic
968907837 4:3462840-3462862 CACTGAGGTGACCCCTCCCCAGG - Intergenic
969476583 4:7425669-7425691 GACTGAGCTGGGCCCTCTGCAGG - Intronic
969676747 4:8618613-8618635 CAGTGTGCCCAGCCCTCAGCAGG + Intronic
970407689 4:15778941-15778963 CCCTGAGCCCAGCCCCTCGCCGG + Intronic
970776424 4:19679697-19679719 CACTGAGCCCAGCCCTGTGGAGG + Intergenic
972325005 4:38007060-38007082 CACTGAGACGAGACATGCGCAGG + Intronic
975673095 4:76801668-76801690 CACTGTGCCTGGCCCTCAGCAGG + Intergenic
977292301 4:95177358-95177380 CCCTGAGCTGAGCACTCAGCAGG - Intronic
977536538 4:98261314-98261336 CTCGGAGCCGCGCCCGCCGCAGG + Intergenic
982579766 4:157162688-157162710 CACTGAGACGAACCCTCCAGAGG - Intronic
986484363 5:8220403-8220425 GACTGGGCAGAGCCCACCGCAGG + Intergenic
990686226 5:58304133-58304155 CACTGCGCCCAGCCCTCTACTGG + Intergenic
992380053 5:76227902-76227924 CACTTAGCTGAGACCTCTGCAGG + Intronic
994926751 5:106126106-106126128 CACTGAGCCCGGCCCTCACCTGG - Intergenic
997439592 5:133899740-133899762 CACTGAGCCATGCCTTCTGCAGG + Intergenic
998376560 5:141694766-141694788 CACAGAACCGAGCCTTCAGCAGG - Intergenic
1000483822 5:161813467-161813489 CACTGCGCTGAGCCCCCCACAGG + Intergenic
1001430911 5:171661317-171661339 CACTGAGCCAAGCACTCCACAGG + Intergenic
1001620586 5:173081632-173081654 CACTGTGCCTAGCCGGCCGCTGG - Intronic
1010725587 6:79328962-79328984 CACTGTGCCCAGCCCTTAGCAGG + Intergenic
1017787712 6:157769957-157769979 CACTGAGCCCAACCATGCGCTGG - Intronic
1018890825 6:167980346-167980368 CACTAAGAAGAGCCCTCGGCTGG + Intergenic
1020081270 7:5287127-5287149 CACTGCGCCCAGCCCTCACCTGG - Intronic
1020283645 7:6664120-6664142 CGCTGAGCCCAAGCCTCCGCGGG - Intergenic
1025197641 7:56945048-56945070 CACTGTGCCCAGCCCTCACCTGG + Intergenic
1025674305 7:63631890-63631912 CACTGTGCCCAGCCCTCACCTGG - Intergenic
1026846934 7:73703848-73703870 CACTGAGCCCAGCCCTCTTCGGG + Intronic
1027232816 7:76282216-76282238 CACTGATCCCAGCCCCCCGACGG + Intronic
1029199501 7:98829143-98829165 CACTGAGCCCAGCCCTTCTAGGG - Intergenic
1029304896 7:99611856-99611878 CAGTGATCCAAGCCCTCCACTGG + Intergenic
1035167578 7:157000560-157000582 CACTCAGCGCTGCCCTCCGCTGG + Intronic
1036618295 8:10405182-10405204 CACTGAGCCCAGCCTCCCTCTGG + Intronic
1037914987 8:22767795-22767817 CAGTGAGCCGAGCCCAGCGTGGG - Intronic
1038472525 8:27837587-27837609 CCCGGAGCCGAGGCCTCTGCGGG - Intronic
1038525144 8:28266862-28266884 CTCTGAGCCTAGCCCTGCCCTGG + Intergenic
1039629346 8:39091809-39091831 CTCTGAGCCAAGGACTCCGCTGG - Intronic
1040599555 8:48870388-48870410 CACCCACCCGAGCCCTGCGCGGG + Intergenic
1042143826 8:65706541-65706563 CACTGAGCCCAGCCCAGTGCAGG + Intronic
1048823038 8:138397158-138397180 CACGGAGCCCAGCCTTCCGTAGG - Intronic
1049471604 8:142777344-142777366 CCCCGAGCCGAGCTCACCGCAGG + Intronic
1049592499 8:143468967-143468989 CACGTGGCCAAGCCCTCCGCGGG - Intronic
1049690849 8:143958202-143958224 CACTGAGCCCCACCCTGCGCAGG - Intronic
1059982918 9:119793094-119793116 CACTGAGCATAGCCCTTCCCTGG + Intergenic
1061231652 9:129319165-129319187 CACGAAGCCGATCCCTCCCCAGG + Intergenic
1061325849 9:129863817-129863839 CACTGCGCCTGGCCCTACGCTGG - Intronic
1190822276 X:53985062-53985084 CACTGTGCCCAGCCCACTGCTGG + Exonic
1199700536 X:150372311-150372333 CACCCAGCCAAGCCCTCCACAGG - Intronic