ID: 1152758711

View in Genome Browser
Species Human (GRCh38)
Location 17:82097718-82097740
Sequence GGACGCCGCGAGGGAGGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 163}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152758711_1152758735 29 Left 1152758711 17:82097718-82097740 CCCGTTCCTCCCTCGCGGCGTCC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1152758735 17:82097770-82097792 GCTCCGGGAGGAGGATGCGGCGG 0: 1
1: 1
2: 5
3: 37
4: 426
1152758711_1152758734 26 Left 1152758711 17:82097718-82097740 CCCGTTCCTCCCTCGCGGCGTCC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1152758734 17:82097767-82097789 GCGGCTCCGGGAGGAGGATGCGG 0: 1
1: 0
2: 3
3: 40
4: 479
1152758711_1152758719 -10 Left 1152758711 17:82097718-82097740 CCCGTTCCTCCCTCGCGGCGTCC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1152758719 17:82097731-82097753 CGCGGCGTCCCCTTCGGGCTGGG 0: 1
1: 0
2: 1
3: 2
4: 63
1152758711_1152758732 20 Left 1152758711 17:82097718-82097740 CCCGTTCCTCCCTCGCGGCGTCC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1152758732 17:82097761-82097783 TCCGGGGCGGCTCCGGGAGGAGG 0: 1
1: 0
2: 4
3: 31
4: 281
1152758711_1152758731 17 Left 1152758711 17:82097718-82097740 CCCGTTCCTCCCTCGCGGCGTCC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1152758731 17:82097758-82097780 GGCTCCGGGGCGGCTCCGGGAGG 0: 1
1: 0
2: 5
3: 46
4: 369
1152758711_1152758727 7 Left 1152758711 17:82097718-82097740 CCCGTTCCTCCCTCGCGGCGTCC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1152758727 17:82097748-82097770 GCTGGGCCTCGGCTCCGGGGCGG 0: 1
1: 0
2: 9
3: 33
4: 291
1152758711_1152758726 4 Left 1152758711 17:82097718-82097740 CCCGTTCCTCCCTCGCGGCGTCC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1152758726 17:82097745-82097767 CGGGCTGGGCCTCGGCTCCGGGG 0: 1
1: 0
2: 2
3: 35
4: 375
1152758711_1152758725 3 Left 1152758711 17:82097718-82097740 CCCGTTCCTCCCTCGCGGCGTCC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1152758725 17:82097744-82097766 TCGGGCTGGGCCTCGGCTCCGGG 0: 1
1: 0
2: 3
3: 24
4: 343
1152758711_1152758729 13 Left 1152758711 17:82097718-82097740 CCCGTTCCTCCCTCGCGGCGTCC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1152758729 17:82097754-82097776 CCTCGGCTCCGGGGCGGCTCCGG 0: 1
1: 0
2: 0
3: 22
4: 184
1152758711_1152758730 14 Left 1152758711 17:82097718-82097740 CCCGTTCCTCCCTCGCGGCGTCC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1152758730 17:82097755-82097777 CTCGGCTCCGGGGCGGCTCCGGG 0: 1
1: 0
2: 2
3: 24
4: 221
1152758711_1152758720 -4 Left 1152758711 17:82097718-82097740 CCCGTTCCTCCCTCGCGGCGTCC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1152758720 17:82097737-82097759 GTCCCCTTCGGGCTGGGCCTCGG 0: 1
1: 0
2: 1
3: 19
4: 175
1152758711_1152758724 2 Left 1152758711 17:82097718-82097740 CCCGTTCCTCCCTCGCGGCGTCC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1152758724 17:82097743-82097765 TTCGGGCTGGGCCTCGGCTCCGG 0: 1
1: 0
2: 2
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152758711 Original CRISPR GGACGCCGCGAGGGAGGAAC GGG (reversed) Intronic
900013852 1:136174-136196 GGCCACCGTGAGGGAGGAACAGG - Intergenic
900014152 1:137329-137351 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
900043922 1:492157-492179 GGCCACCGTGAGGGAGGAACAGG - Intergenic
900044015 1:492531-492553 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
900065359 1:727160-727182 GGCCACCGTGAGGGAGGAACAGG - Intergenic
900065425 1:727437-727459 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
906108954 1:43310873-43310895 GGAGGGAGCGAGGGAGGAAAAGG - Intronic
906153552 1:43601361-43601383 AGACACCCCGAGGAAGGAACGGG + Intronic
919878974 1:201889673-201889695 GGAGTCCGGGAGGGAGGAAGAGG - Intronic
922100582 1:222474462-222474484 GGTCACCGTGAGGGAGGAGCTGG + Intergenic
922734047 1:227970214-227970236 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
922734155 1:227970657-227970679 GGCCGCCGGGAGGCAGGAGCTGG - Intergenic
922734438 1:227971753-227971775 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
922734484 1:227971934-227971956 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
922734726 1:227972885-227972907 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
922734765 1:227973065-227973087 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
922802705 1:228371556-228371578 GGAGGCCGCCAGGGAGGAGCAGG + Exonic
924343447 1:243054771-243054793 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
924343479 1:243054904-243054926 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
924801340 1:247331439-247331461 GGACGCCGGGAGGGAGCTCCAGG - Exonic
924861273 1:247925081-247925103 GGACACCATGAGGGAGGAAGGGG + Intergenic
1066733023 10:38450744-38450766 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1067084498 10:43230596-43230618 GGCGGCCGCTAGGGAGGAGCAGG + Intronic
1067161062 10:43825651-43825673 GGTCTCTGGGAGGGAGGAACAGG - Intergenic
1067214915 10:44293555-44293577 GGTCTCCCGGAGGGAGGAACAGG + Intronic
1069949109 10:72007352-72007374 GGAGGCCGCAGGGGAGGAAGAGG + Exonic
1071506509 10:86235051-86235073 GGAGGCCGAGAGGGCTGAACTGG - Intronic
1075396843 10:122133827-122133849 GAACTCCTTGAGGGAGGAACTGG + Intronic
1076374047 10:129971860-129971882 GGACGCTGAGAGGGAGGAGGCGG - Intergenic
1076494844 10:130890169-130890191 GGAAGCCGGGATGGAGGAAGGGG + Intergenic
1076655393 10:132020181-132020203 GGAGGGAGGGAGGGAGGAACAGG - Intergenic
1076970196 11:128388-128410 GGCCACCGTGAGGGAGGAACAGG - Intergenic
1076970352 11:129006-129028 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1079005837 11:16790644-16790666 GGATGCCAAGAGGGAGGACCTGG - Intronic
1082260363 11:50073079-50073101 GGCCGCTGTGAGGGAGGAGCTGG + Intergenic
1084311395 11:68318281-68318303 GGAAGCCGAGCGGGAGGATCAGG - Intronic
1084795317 11:71501355-71501377 GGAGGCCTCCAGGAAGGAACCGG - Exonic
1085039535 11:73318692-73318714 AGAAGCCGCCAGGCAGGAACAGG + Intronic
1093005056 12:14042506-14042528 GGACGCAGCGGGGGAGGCATGGG + Intergenic
1093406824 12:18814236-18814258 GGACGAAGGGAGGCAGGAACAGG - Intergenic
1097046170 12:56189234-56189256 GGAGGCCGCGGGGGAGGGGCTGG + Intronic
1102729840 12:115098758-115098780 GGACATAGCGAGGGAGGAAATGG - Intergenic
1103239020 12:119398017-119398039 GGGCGGCGGGAGGGAGGAAGGGG + Intronic
1103402854 12:120654960-120654982 GGAAGGCGGGAGGGAGGAAAAGG + Intronic
1103843808 12:123887428-123887450 GGCCGCCGTGAGGGAGGAACAGG - Intronic
1110436542 13:75482416-75482438 GGAAGGAGCGAGGGAGGGACGGG - Intergenic
1113037013 13:106061846-106061868 AGACGCCAGGAGGGAGGAAGCGG - Intergenic
1119197722 14:72729767-72729789 GGACGGAGGGAGGGATGAACAGG + Intronic
1121127820 14:91418709-91418731 GGACGGCACGAGGCAGGAGCCGG + Intergenic
1122048613 14:99040388-99040410 CGACGCCAAGAGGGAGGAAAGGG + Intergenic
1124414246 15:29461902-29461924 GGACGGGGCTAGGGAGGAATGGG - Intronic
1125101450 15:35917682-35917704 GTAGGCTGCGAGGCAGGAACCGG - Intergenic
1125201016 15:37100665-37100687 GGACGGCGGGGGGGAGGAAAAGG + Intronic
1125679834 15:41523688-41523710 GGACACAGAGAGGGAGCAACGGG + Intronic
1127812898 15:62580004-62580026 GGAAGCAGCGATGGAGGATCTGG - Intronic
1129589656 15:76904579-76904601 GAACGGCACCAGGGAGGAACGGG - Intronic
1132631308 16:918983-919005 GGAGGCCCCGTGGGAGGAGCAGG - Intronic
1134149692 16:11796577-11796599 GGGCGCCGCCCGGGAGGACCGGG - Intronic
1134625378 16:15719251-15719273 GGACCTCGAGAAGGAGGAACTGG - Exonic
1136365126 16:29806288-29806310 GGAGGGCGCGAGGGAGGGAGGGG - Intronic
1139467815 16:67163643-67163665 GAACGCCGCGCTGGAGGAGCTGG + Exonic
1141886817 16:86898115-86898137 GGAGGGAGGGAGGGAGGAACAGG - Intergenic
1142346428 16:89556997-89557019 CGACGCCCAGAGGGAGAAACAGG + Exonic
1142450481 16:90170744-90170766 GGCCACCGTGAGGGAGGAACAGG + Intergenic
1142457081 17:62947-62969 GGCCACCGTGAGGGAGGAACAGG - Intergenic
1142457187 17:63370-63392 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1144727997 17:17511410-17511432 GGTCCCCCCGAGGGAGGAAGTGG - Intronic
1145394897 17:22487235-22487257 GGAGGCAGAGAGGGAGGCACTGG + Intergenic
1145807243 17:27743484-27743506 GGAAGCCAGGAGGGAGAAACAGG - Intergenic
1146126874 17:30237342-30237364 GGATGCCGCGAGGGGTGAAGGGG + Intergenic
1147325570 17:39667977-39667999 GGGCGCTGCGAGGGGGAAACTGG + Intronic
1149772463 17:59332170-59332192 GGACGACGCGGAGGAGGAAGCGG - Intronic
1150624807 17:66835061-66835083 GGACCCCGAGAGGGAGGGGCGGG - Intergenic
1151623534 17:75262011-75262033 GGGCGCTGCGAGGAAGGAAGGGG + Intronic
1152024988 17:77803027-77803049 GGATGGAGCGAGGGAGGAAGTGG - Intergenic
1152758711 17:82097718-82097740 GGACGCCGCGAGGGAGGAACGGG - Intronic
1155654418 18:28177402-28177424 GGAAGCCGCGAGGGATGCAGCGG + Exonic
1157595518 18:48861451-48861473 GGAGGCCTCGAGGGAGGAGCCGG + Exonic
1159964093 18:74579263-74579285 GGAGGGCGGGAGGAAGGAACAGG - Intronic
1160497093 18:79382123-79382145 GGATGCCCCAAGGAAGGAACAGG - Intergenic
1160646994 19:198306-198328 GGCCACCGTGAGGGAGGAACAGG - Intergenic
1160647546 19:200475-200497 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1160765801 19:807119-807141 GGCCCCCGCGAGGGAGGGCCAGG - Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1165307992 19:35013808-35013830 GGAGGCCTGGATGGAGGAACAGG + Intronic
1165784453 19:38453019-38453041 GGACGTGGCGAGGGCGGAGCGGG + Intronic
1166139838 19:40799803-40799825 GGAAGCTGGGAGGGAGGACCCGG - Exonic
1166562811 19:43744554-43744576 GGAGGGAGGGAGGGAGGAACAGG + Intronic
1166750303 19:45161345-45161367 GGCTGTCGCGAGGGAGGCACTGG + Intronic
1167105925 19:47429860-47429882 GGTCACCGCAGGGGAGGAACCGG + Exonic
925371634 2:3349610-3349632 GGACGCCGGGAGACAGGGACAGG + Intronic
927824614 2:26299304-26299326 GTGCGCCGCAAGGGAGGAAATGG + Intergenic
928093925 2:28392721-28392743 GGAGGCCGCGGAGGAGGAAGAGG - Intronic
934296888 2:91749213-91749235 GCACGCAGGGAGGGAGGCACAGG + Intergenic
944176270 2:196831747-196831769 GTACTCCGCCAGTGAGGAACTGG - Intergenic
946076367 2:217076944-217076966 GGACGCCACCAGGAAGGAAGGGG + Intergenic
947670046 2:231930124-231930146 GGTCCCCAGGAGGGAGGAACAGG + Intergenic
947747596 2:232516989-232517011 GGAGGCAGTGAGGGAGGAAGAGG + Intergenic
949036420 2:241817548-241817570 GGAAGGCGGGAGGGAGGAAGTGG + Intergenic
1169065341 20:2692019-2692041 GGACGCGGCTGGGGAGAAACAGG + Intergenic
1172702814 20:36863332-36863354 GGAGGCCGCGATGGAGGCGCCGG - Exonic
1175056959 20:56207669-56207691 GGACAAGTCGAGGGAGGAACTGG - Intergenic
1176430206 21:6570860-6570882 AGACGGCACGAGGGAGGAGCGGG + Intergenic
1179705600 21:43178322-43178344 AGACGGCACGAGGGAGGAGCGGG + Intergenic
1180005583 21:45019028-45019050 GGACCCCGCGCGGGAGGACCCGG - Intergenic
1181777817 22:25172207-25172229 GGAGACCCCGAGAGAGGAACGGG - Intronic
1182417923 22:30233119-30233141 GGAACCCCCGAGGGAGGCACTGG - Intergenic
1182589149 22:31365478-31365500 GGAGGCAGGGAGGGAGGAAAGGG + Intergenic
950361195 3:12450556-12450578 GGACACCGTGGGGAAGGAACTGG + Intergenic
950516995 3:13473484-13473506 GGATGCCGGGAGGGAGGAAATGG + Intergenic
954138906 3:48595050-48595072 GGGCACCGCAAGGGAGGACCCGG - Intronic
955821222 3:62897715-62897737 GGACGAAGAGAGGGAAGAACAGG - Intergenic
965796796 3:172448502-172448524 GGAGGGTGCGAGGGAGGAGCGGG + Intergenic
967272659 3:187743927-187743949 GGACCCGGCGCGGGAGGAGCGGG - Intronic
968370295 3:198219637-198219659 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
968370688 3:198221217-198221239 GGCCACCGTGAGGGAGGAACAGG + Intergenic
969265613 4:6062311-6062333 GGACGCTGAGAGGGAGGCCCGGG - Exonic
971831484 4:31701477-31701499 GGACGTCGAGAGGAAGGCACGGG + Intergenic
972559648 4:40215478-40215500 GGAGGGAGCGAGGGAGGACCAGG - Intronic
979259318 4:118633557-118633579 GGCCGCCGGGAGGCAGGAGCTGG - Intergenic
979318971 4:119300781-119300803 GGACGCCGCGAGGCAGAAGTAGG - Intronic
985647991 5:1094028-1094050 GGACACCACGTGGAAGGAACTGG - Intronic
988598755 5:32620243-32620265 GGGGGAAGCGAGGGAGGAACAGG - Intergenic
990954873 5:61331776-61331798 GGTCGCAGCGGGGGAGGAAAGGG - Intergenic
992104004 5:73435876-73435898 GGACGAGGAGAGGGAGGAGCTGG + Intergenic
997187688 5:131898719-131898741 GGACCCCGTGAGCGAGGCACGGG + Intronic
999481234 5:151949991-151950013 GGAAGGCGCGAGAGAGGAAGTGG - Intergenic
1001652936 5:173328258-173328280 GGAAGCGGCGAAGGAGGAAGAGG - Exonic
1002729828 5:181326398-181326420 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1002729921 5:181326772-181326794 GGCCACCGTGAGGGAGGAACAGG + Intergenic
1004581521 6:16958710-16958732 GGAAGCAGGGAGGGAGGACCCGG + Intergenic
1019614588 7:1953389-1953411 GGCCCCCGCCAGGGAGGAGCAGG + Intronic
1023400761 7:39792088-39792110 GGGCGCCGGGAGGCAGGAGCTGG - Intergenic
1023401054 7:39793182-39793204 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1023401086 7:39793314-39793336 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1024074123 7:45810160-45810182 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1024074496 7:45811651-45811673 GGCCACCGTGAGGGAGGAACTGG - Intergenic
1024074826 7:45813009-45813031 GGCCACCGTGAGGGAGGAACTGG - Intergenic
1024075069 7:45813974-45813996 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1024648525 7:51387367-51387389 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1024648581 7:51387597-51387619 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1024649209 7:51390038-51390060 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1025052527 7:55742420-55742442 GGCCACCGTGAGGGGGGAACTGG + Intergenic
1025052766 7:55743383-55743405 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1025052912 7:55743877-55743899 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1025053289 7:55745368-55745390 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1025129335 7:56367518-56367540 GGCCCCCGTGAGGGAGGAGCAGG - Intergenic
1025129815 7:56369427-56369449 GGCCACCGTGAGGGAGGAAGTGG + Intergenic
1025130123 7:56370681-56370703 GGCCACCGTGAGGGAGGAACTGG + Intergenic
1025130355 7:56371619-56371641 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1025130443 7:56371979-56372001 GGCCACCGTGAGGGAGGCACTGG + Intergenic
1025130675 7:56372917-56372939 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1025130761 7:56373273-56373295 GGCCCCCGTGAGGGAGGAACTGG + Intergenic
1025130990 7:56374210-56374232 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1025131078 7:56374570-56374592 GGCCACCGTGAGGGAGGAACTGG + Intergenic
1025176440 7:56804583-56804605 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1026045737 7:66904307-66904329 GGCCGCCGCGAGGCACGAGCTGG - Intergenic
1026630968 7:72037958-72037980 GGAAGGCGAGATGGAGGAACAGG + Intronic
1026955281 7:74372868-74372890 GGACGCAGGGAGGGGGGCACAGG - Intronic
1031323701 7:120365230-120365252 GGAGGCAGGGAGGGAGGGACGGG + Intronic
1032051590 7:128653696-128653718 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1038977097 8:32711711-32711733 GTAGGTCACGAGGGAGGAACTGG - Intronic
1047255469 8:123210348-123210370 GGCCGCAGTGAGGGAGGTACAGG - Intergenic
1047408329 8:124603648-124603670 GGAGGCAGAGAGGGAGGAAATGG + Intronic
1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG + Intergenic
1049532293 8:143160491-143160513 GGGCGCCGCGAGGGAGGGAGCGG - Intronic
1049557641 8:143291072-143291094 GGACGCCGCGGGGAACGGACGGG + Intronic
1052305689 9:27006689-27006711 GGAGGCAGGGAGGGAGGAAAAGG + Intronic
1052640997 9:31165767-31165789 GGACCAGGCGAGGGAGGAAGAGG - Intergenic
1057942467 9:99296830-99296852 GGAAGCCTCGAGGGATAAACAGG + Intergenic
1058704353 9:107626378-107626400 TGAGGCCGGGAGGGAGTAACGGG + Intergenic
1058721512 9:107768667-107768689 GGACTCCACGAGGCAGGAAATGG - Intergenic
1060268453 9:122125803-122125825 GGAGGCTGGGAGGGAGGGACTGG - Intergenic
1061517148 9:131096571-131096593 GGACGCGGCGAGGGACGAGGAGG - Exonic
1062278395 9:135741265-135741287 GGACGCGGCCAGGGAGCACCTGG + Intronic
1062435969 9:136546684-136546706 GGGCGCCCCGAGGGAGCAGCCGG + Intergenic
1062540238 9:137038843-137038865 GAAGGCCCCGAGGGAGGAAGGGG - Intergenic
1062754240 9:138278910-138278932 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1062754336 9:138279286-138279308 GGCCACCGTGAGGGAGGAACAGG + Intergenic
1203577800 Un_KI270745v1:21667-21689 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1203578240 Un_KI270745v1:23446-23468 GGCCACCGTGAGGGAGGAACAGG + Intergenic
1187037952 X:15562105-15562127 GGAGGCTGGGAGGGAGGAACAGG + Intronic
1187669523 X:21655886-21655908 GGACGACGAGAGGGAGGGAGAGG - Exonic
1200128211 X:153828124-153828146 GGAGGCCGGGAGGCAGGCACGGG + Intronic
1200835480 Y:7727520-7727542 AGACCCCGCTAGGGAGGAATGGG - Intergenic
1201524693 Y:14919394-14919416 GGAGGCAGGGAGGGAGGAAGGGG + Intergenic
1202380874 Y:24276056-24276078 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1202489910 Y:25394069-25394091 GGCCACCGTGAGGGAGGAGCAGG - Intergenic