ID: 1152760977

View in Genome Browser
Species Human (GRCh38)
Location 17:82106912-82106934
Sequence GTGGGCACCCTAGCATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152760965_1152760977 21 Left 1152760965 17:82106868-82106890 CCATGGGGCCTTCCCAGGTCTGC 0: 1
1: 1
2: 4
3: 53
4: 378
Right 1152760977 17:82106912-82106934 GTGGGCACCCTAGCATCTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1152760970_1152760977 -1 Left 1152760970 17:82106890-82106912 CCAGGCCAGCTTACAGCTCCAGG 0: 1
1: 1
2: 1
3: 22
4: 238
Right 1152760977 17:82106912-82106934 GTGGGCACCCTAGCATCTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1152760967_1152760977 13 Left 1152760967 17:82106876-82106898 CCTTCCCAGGTCTGCCAGGCCAG 0: 1
1: 1
2: 3
3: 43
4: 364
Right 1152760977 17:82106912-82106934 GTGGGCACCCTAGCATCTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1152760969_1152760977 8 Left 1152760969 17:82106881-82106903 CCAGGTCTGCCAGGCCAGCTTAC 0: 1
1: 0
2: 1
3: 6
4: 139
Right 1152760977 17:82106912-82106934 GTGGGCACCCTAGCATCTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1152760964_1152760977 22 Left 1152760964 17:82106867-82106889 CCCATGGGGCCTTCCCAGGTCTG 0: 1
1: 0
2: 2
3: 23
4: 176
Right 1152760977 17:82106912-82106934 GTGGGCACCCTAGCATCTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1152760968_1152760977 9 Left 1152760968 17:82106880-82106902 CCCAGGTCTGCCAGGCCAGCTTA 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1152760977 17:82106912-82106934 GTGGGCACCCTAGCATCTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1152760974_1152760977 -6 Left 1152760974 17:82106895-82106917 CCAGCTTACAGCTCCAGGTGGGC 0: 1
1: 1
2: 0
3: 20
4: 144
Right 1152760977 17:82106912-82106934 GTGGGCACCCTAGCATCTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152760977 Original CRISPR GTGGGCACCCTAGCATCTCA GGG Intronic
906848494 1:49221279-49221301 GTGGGGATCCTATAATCTCAGGG - Intronic
911292827 1:96079076-96079098 GGGGGCATTCAAGCATCTCATGG - Intergenic
911400327 1:97366797-97366819 GTAGCCTCCCTGGCATCTCATGG - Intronic
915042464 1:152980676-152980698 GGGGTCTCCCTAGCTTCTCAAGG + Intergenic
916480558 1:165210800-165210822 GTAGACACACTGGCATCTCAGGG + Intronic
918574804 1:186044820-186044842 GTGGGCTCCATAACTTCTCAAGG - Intronic
920311296 1:205049985-205050007 CAGGGCACTCTAGCACCTCATGG + Intronic
920452425 1:206069611-206069633 CTGGTCACCCTAGCAGCTGAGGG + Intronic
922802565 1:228371067-228371089 GTGGGCCCCGCAGCAGCTCAGGG - Exonic
1067086054 10:43238743-43238765 GTGGGCAGCAATGCATCTCAGGG + Intronic
1069623274 10:69850945-69850967 GGCAGCACCCTAGCATCTGAAGG + Intronic
1070959039 10:80486131-80486153 GTGTGGACCCCAGCATCTGAAGG + Intronic
1071118620 10:82252072-82252094 GTGGGCTCCCAACCAGCTCAGGG + Intronic
1073617768 10:105015152-105015174 GTGGGAACCCTAGTATGTCCTGG + Intronic
1074221705 10:111444555-111444577 CTGGGCACCCAAGGACCTCATGG + Intergenic
1075004532 10:118820496-118820518 GTGGCCAAGCTGGCATCTCATGG + Intergenic
1077011288 11:380466-380488 GTGGGAACCCTGGTATCACAGGG - Intronic
1077951047 11:6957435-6957457 GAGCGCATCCTAGCAGCTCAGGG - Exonic
1081827097 11:46065942-46065964 GTGCCCGCCCTAACATCTCATGG - Intronic
1085098615 11:73781312-73781334 CTGGGCTGCTTAGCATCTCAGGG - Intergenic
1089168647 11:116497478-116497500 GTGTGCAACCCAGCGTCTCAAGG - Intergenic
1089323916 11:117644420-117644442 ATGGGCACACTAGCATCTTTTGG - Intronic
1103344259 12:120238806-120238828 GGGTTCACCCTAGCACCTCATGG - Intronic
1104274339 12:127310971-127310993 GTGGGAACGCCAGCATCACATGG + Intergenic
1109078101 13:57864257-57864279 CTGGGGACCCAAGCAACTCAGGG + Intergenic
1113617617 13:111692379-111692401 GTGGGCAGCCTGGCAGCTCAGGG - Intergenic
1113623147 13:111777639-111777661 GTGGGCAGCCTGGCAGCTCAGGG - Intergenic
1115965752 14:38885567-38885589 GTGGGCACTCTGGGATTTCATGG - Intergenic
1117177791 14:53162820-53162842 GTAGGCACCAAAGAATCTCATGG - Intergenic
1120256094 14:82121468-82121490 CTGGGCACTCTAGAATATCATGG - Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122972183 14:105156867-105156889 GTGGGGACCCCAGCGGCTCAGGG - Intronic
1125599769 15:40908959-40908981 CTGGGCATCCTGGCATCTTATGG - Intergenic
1133103564 16:3493516-3493538 GTGGGCTCCCCGGCCTCTCAGGG + Exonic
1133702247 16:8319678-8319700 GTGAGCAGCCTACCTTCTCAGGG - Intergenic
1133765189 16:8832867-8832889 GAGGGAACCCTGGCATCTGAGGG - Intronic
1135380602 16:21993249-21993271 GTGGGCAACAGAGAATCTCATGG - Intronic
1139379398 16:66521113-66521135 GTGGGCACCCTCCCAGCTCTGGG - Intronic
1142894211 17:2963934-2963956 GTGGGCACCCCAACATCGCTGGG + Exonic
1147148209 17:38498360-38498382 GTTGGCAGCCCAGCATCTGAGGG + Intronic
1151934559 17:77254129-77254151 GTGGGCACCCTGGCTTCTGGAGG + Intergenic
1152760977 17:82106912-82106934 GTGGGCACCCTAGCATCTCAGGG + Intronic
1157181542 18:45502567-45502589 TTGATCACTCTAGCATCTCATGG - Intronic
1160722305 19:603053-603075 GTGGGCACCCTCGCCCCCCAGGG + Intronic
1160722361 19:603210-603232 GTGGGCACCCTCGCCCCCCAGGG + Intronic
1160722392 19:603289-603311 GTGGGCACCCTCGCCCCCCAGGG + Intronic
1161801209 19:6417624-6417646 GTGGCCTCCATAGCACCTCACGG - Intronic
1163573702 19:18098438-18098460 GAGGGCACCCTTGCTTCTCTGGG + Intronic
1164980113 19:32607494-32607516 GTGTGCACCTCAGAATCTCAGGG + Intronic
928368906 2:30724627-30724649 CTGGACACCCTGGCATCTCAAGG + Intronic
929772381 2:44903210-44903232 GTGGGGAGCTTATCATCTCAAGG + Intergenic
931614106 2:64138270-64138292 GTAGGCACGCTCCCATCTCAGGG + Intronic
934559127 2:95303250-95303272 GTGGGCCACCTGGCCTCTCAGGG + Intronic
938289238 2:130140721-130140743 GTGCGCTCTGTAGCATCTCAGGG + Intronic
942403805 2:175631266-175631288 ATGACCACCCCAGCATCTCAGGG + Intergenic
948332195 2:237178402-237178424 GGGGGCATCCTGGCATCTCATGG + Intergenic
1172840760 20:37901816-37901838 GTGTGAACCCTAGCATCAAAGGG + Intergenic
1173147583 20:40537979-40538001 TGGGGCACCCTGGCATCTCTGGG - Intergenic
1175006025 20:55684466-55684488 TTGGGCAACCTATCATCACAGGG + Intergenic
1180963459 22:19773446-19773468 GGGGGCACCCTAGCACCCCACGG + Intronic
1184032608 22:41903839-41903861 GTGGGCCCCGCAGCACCTCAGGG - Intronic
1184433836 22:44458216-44458238 GTGGGCACACTAGCTCCCCAGGG - Intergenic
1185340116 22:50287411-50287433 GTGGTCACCCCAGCAACTCCTGG + Intronic
954685773 3:52369401-52369423 CTGGGCACAAGAGCATCTCAGGG + Intronic
960950436 3:122995411-122995433 GTGGCCACCCTGTCATCCCAGGG - Intronic
962170537 3:133097003-133097025 GTCCGCACCCTTGCATGTCACGG + Intronic
962920192 3:139943565-139943587 GTAGACACCCCAGGATCTCAAGG - Intronic
968085841 3:195873554-195873576 GTGTCCACCCTAGCAGCTCTGGG - Intronic
969247908 4:5947564-5947586 AGGGGCTCCCTAGCCTCTCAGGG - Intronic
978735178 4:112076937-112076959 GTGTGCCCCACAGCATCTCAGGG - Intergenic
985552882 5:542182-542204 GTGGGCACCCCAGCTTTTCAGGG - Intergenic
985842312 5:2317594-2317616 GTGGGCACTCTGGCTTCTCCTGG + Intergenic
985924982 5:3008872-3008894 GTGGGCACCCTGGCATCAGTTGG + Intergenic
986036783 5:3948517-3948539 GCAGGCACCCCAGCATGTCATGG + Intergenic
991501784 5:67284100-67284122 TTGGCCACCCTATTATCTCATGG - Intergenic
993075576 5:83226086-83226108 GTGGGCACACGAGCACCTCCAGG - Intronic
995433150 5:112105013-112105035 GTGGCAACTCTAGCACCTCATGG - Intergenic
998251364 5:140555588-140555610 TAGGGCACTCTAGCATTTCAAGG - Intronic
999254063 5:150199872-150199894 GAGGTCACCCTAGCAGCTCTAGG + Intronic
1000516484 5:162241469-162241491 GTGTGCCCCCTAGGGTCTCAGGG + Intergenic
1007067640 6:39007987-39008009 CTGGTCAACCCAGCATCTCAGGG + Intronic
1007258308 6:40544032-40544054 TTGGGTAGCCCAGCATCTCAGGG - Intronic
1013692702 6:112665323-112665345 GTCAGCACCCTAGGATCTCTGGG + Intergenic
1015349301 6:132198131-132198153 TTGGGCATCTAAGCATCTCAGGG - Intergenic
1019160134 6:170063878-170063900 CTGTGCACCCCACCATCTCAGGG + Intergenic
1019160234 6:170064461-170064483 GTGGGCAGCCCAGGATCTCCTGG - Intergenic
1019223724 6:170494379-170494401 CTGGGCACACCAGCATCTGAGGG - Intergenic
1031925688 7:127636125-127636147 GTGAGCACCCAAGCAGTTCAGGG + Intergenic
1033241437 7:139682913-139682935 GAGGGCCCCCTGGCATCACAGGG + Intronic
1033477591 7:141705683-141705705 GCGGGCAGCCTTGCATCTCAGGG - Intergenic
1034037495 7:147839643-147839665 GTTGTCACACTAGCACCTCATGG - Intronic
1035268318 7:157704570-157704592 CTGGGCACCCTACCACCTCCTGG + Intronic
1037428553 8:18784762-18784784 GTGGGCATCCCAACATCACAGGG - Intronic
1043917888 8:85944898-85944920 GTGGTGACCATAACATCTCAGGG - Intergenic
1045540138 8:103076262-103076284 GTGGGCAGACTAGCATCCCAGGG + Intergenic
1048057954 8:130886649-130886671 GAGGGCACCCTGGCATCCCAAGG - Intronic
1048275580 8:133063245-133063267 GGGGGCACCCTGGCATCTGGAGG - Intronic
1049368299 8:142251466-142251488 GTGGGCCCACGAGCAGCTCAGGG + Intronic
1053020658 9:34691707-34691729 GAGGCCACCCCAGGATCTCATGG - Intergenic
1059998441 9:119936414-119936436 CTGGGCTCCTGAGCATCTCAAGG + Intergenic
1060392650 9:123291042-123291064 CTGGGCAACCTAACTTCTCAGGG - Intergenic
1061245642 9:129400181-129400203 GTGTGCTCCCTCGCGTCTCACGG - Intergenic
1185701699 X:2235716-2235738 CTGGGCAACAGAGCATCTCAGGG + Intronic
1194545828 X:95232285-95232307 GTGAGCAGCCTACCTTCTCAAGG + Intergenic
1199771982 X:150981009-150981031 CAGAGCACCCTAGCCTCTCAAGG - Intronic