ID: 1152766782

View in Genome Browser
Species Human (GRCh38)
Location 17:82145741-82145763
Sequence CCCCACTCAGGGGCCTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 1, 2: 4, 3: 37, 4: 392}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152766782_1152766789 -1 Left 1152766782 17:82145741-82145763 CCCCTGCAGGCCCCTGAGTGGGG 0: 1
1: 1
2: 4
3: 37
4: 392
Right 1152766789 17:82145763-82145785 GCTGTTCTCACTCCCCGCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 185
1152766782_1152766791 9 Left 1152766782 17:82145741-82145763 CCCCTGCAGGCCCCTGAGTGGGG 0: 1
1: 1
2: 4
3: 37
4: 392
Right 1152766791 17:82145773-82145795 CTCCCCGCCCTGGTCTCGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 388
1152766782_1152766790 5 Left 1152766782 17:82145741-82145763 CCCCTGCAGGCCCCTGAGTGGGG 0: 1
1: 1
2: 4
3: 37
4: 392
Right 1152766790 17:82145769-82145791 CTCACTCCCCGCCCTGGTCTCGG 0: 1
1: 0
2: 2
3: 10
4: 225
1152766782_1152766798 27 Left 1152766782 17:82145741-82145763 CCCCTGCAGGCCCCTGAGTGGGG 0: 1
1: 1
2: 4
3: 37
4: 392
Right 1152766798 17:82145791-82145813 GCCGGAACCCTGTAGCAGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 97
1152766782_1152766797 23 Left 1152766782 17:82145741-82145763 CCCCTGCAGGCCCCTGAGTGGGG 0: 1
1: 1
2: 4
3: 37
4: 392
Right 1152766797 17:82145787-82145809 CTCGGCCGGAACCCTGTAGCAGG 0: 1
1: 0
2: 1
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152766782 Original CRISPR CCCCACTCAGGGGCCTGCAG GGG (reversed) Intronic