ID: 1152771904

View in Genome Browser
Species Human (GRCh38)
Location 17:82175207-82175229
Sequence CATGAGGGGTAGACCCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152771899_1152771904 -7 Left 1152771899 17:82175191-82175213 CCTGGAGAAACAGTCGCATGAGG 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 242
1152771897_1152771904 14 Left 1152771897 17:82175170-82175192 CCAAAAGGAAGAAAGAATTCTCC 0: 1
1: 0
2: 8
3: 60
4: 555
Right 1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152771904 Original CRISPR CATGAGGGGTAGACCCTGGA AGG Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901920075 1:12529713-12529735 CAGGAAGGGTGGACCCAGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903278344 1:22235964-22235986 AATGAGGGGCAGACCTGGGAAGG + Intergenic
903773735 1:25779988-25780010 TATGAGGGTTAGACCCAGGAGGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908116225 1:60943041-60943063 CATGAGAGGAAGACACTGCATGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910161512 1:84277172-84277194 GATGTGGGGTTGACCTTGGAAGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912806193 1:112758794-112758816 CATGTGGGGTAGGGACTGGAAGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917610466 1:176684051-176684073 CATGCGGGCTAAACCATGGATGG + Intronic
917626021 1:176847117-176847139 CATGAGGAGAGGGCCCTGGAAGG - Intergenic
919162889 1:193853905-193853927 CATGAGGGGTAGACAGGGGCAGG + Intergenic
920991644 1:210945542-210945564 CCTGAGGGGAAGCCCTTGGAAGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922561051 1:226569845-226569867 GAAGAGGGGTAGAGCCTGGCAGG + Intronic
922740329 1:228010770-228010792 GATGTGAGGGAGACCCTGGAGGG - Intronic
924254533 1:242169458-242169480 CTTGTGGGGTAGGCACTGGAGGG - Intronic
924552329 1:245090190-245090212 CATGAGGGAAAGACCCAGGTAGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1067687905 10:48478880-48478902 CATGAGGAGTGGACCATAGAGGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070583919 10:77746757-77746779 CTTGAAGGGTAAACCCTGGCTGG - Intergenic
1071677899 10:87673628-87673650 CTTGAGGGGGAAAACCTGGATGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074943227 10:118255080-118255102 CTTGAGGGGAGGACCCTGGAAGG - Intergenic
1076258903 10:129050455-129050477 CCTGTGGGGTAGAGCCTGGCTGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1081672017 11:44947716-44947738 CATCAGTGGTAGAGCCAGGATGG - Intronic
1081693201 11:45092258-45092280 CATGTGGGGAAGGCCCTGAATGG + Intergenic
1083419957 11:62546919-62546941 CGAGCGGGGCAGACCCTGGAGGG + Intronic
1083581208 11:63826775-63826797 CATGAGGGGAAGCCCAAGGATGG - Intronic
1083904018 11:65658540-65658562 GTTGAGGGGGAGACCATGGAGGG - Intronic
1084216377 11:67648927-67648949 CAGGAGGAGTGGCCCCTGGAGGG - Intronic
1084518154 11:69647417-69647439 CTTGAGGGGTAAGCCCTGGCCGG - Intronic
1085120423 11:73964160-73964182 CATCAGGGGCAGAGCCAGGATGG + Intronic
1085253459 11:75158990-75159012 CATGAAGGGCAGCCCCTTGAAGG + Intronic
1085455075 11:76660996-76661018 CAGGCGGGGCAGACCCTCGAAGG + Exonic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086253352 11:84844448-84844470 GAAGATGGGTAGTCCCTGGAGGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088469260 11:110176392-110176414 CAGGAGGGGTACTGCCTGGATGG - Intronic
1088897464 11:114089209-114089231 TGTGAAGGGTAGATCCTGGAGGG + Intronic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091971308 12:4789330-4789352 CAGGATGGGTGGTCCCTGGAGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093906229 12:24695154-24695176 CATGAGGCTTACACTCTGGAGGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1103477239 12:121227650-121227672 CTTGAGGGGAAGAACCTGGAAGG + Intronic
1105387626 13:19946312-19946334 CAGGCGGGGTGGCCCCTGGAAGG - Intergenic
1106771739 13:32967995-32968017 CATGTAAGGCAGACCCTGGAAGG + Intergenic
1113424367 13:110195881-110195903 CATTAGGTGAAGACCCTGTAAGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115245199 14:31287453-31287475 GATGGGGGGTGGACCATGGATGG + Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117727848 14:58691985-58692007 CAGAAGGCCTAGACCCTGGAAGG + Intergenic
1121739757 14:96243144-96243166 CTGGAGGGCTAGAACCTGGAGGG + Exonic
1121739786 14:96243295-96243317 CTGGAGGGCTAGAACCTGGAGGG + Exonic
1121739803 14:96243371-96243393 CTGGAGGGCTAGAACCTGGAGGG + Exonic
1121739826 14:96243478-96243500 CTGGAGGGCTAGAACCTGGAAGG + Exonic
1122367176 14:101201067-101201089 CATGAGTGGAAGAGGCTGGAGGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122663193 14:103311541-103311563 CTTGGGGGGTGGACGCTGGAGGG - Intergenic
1122788849 14:104176059-104176081 CCTGAGGGGGGGCCCCTGGAGGG + Exonic
1123811636 15:23932546-23932568 CAGGAAGGGCAGACCATGGAGGG + Intergenic
1123821767 15:24037437-24037459 CTTGAGGGCTGGATCCTGGATGG + Intergenic
1123827770 15:24101107-24101129 CAGGAAGGGCAGACCATGGAGGG + Intergenic
1123842224 15:24260516-24260538 CAGGAAGGGCAGACCATGGAGGG + Intergenic
1123874452 15:24609663-24609685 CAGGAAGGGCAGACCATGGAAGG + Intergenic
1123877837 15:24642028-24642050 CAGGAAGGGCAGACCATGGAGGG + Intergenic
1123883272 15:24695774-24695796 CAGGAAGGGCAGACCATGGAGGG + Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127492104 15:59474520-59474542 CATGAGGGCTCCACCCTGAATGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1131298529 15:91173614-91173636 CATGAGGTGTGGACACAGGATGG - Intronic
1132987048 16:2772757-2772779 CATGATGGGAAGCCACTGGATGG - Intronic
1134094843 16:11412483-11412505 CCTGAGGGCTAGAGCCTGGCTGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1138199494 16:55078396-55078418 CTTGAGGGATAGACACTGCAAGG + Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139371476 16:66471939-66471961 GATGCCGGGTAGACCCAGGATGG + Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1141331710 16:83117164-83117186 CATGAGGAGTGAGCCCTGGAAGG - Intronic
1141884272 16:86880991-86881013 CATGAGGGAGAGACTCAGGAAGG + Intergenic
1142376227 16:89708412-89708434 CACGAGGGGTAGACCCTGGCGGG - Exonic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143565412 17:7717611-7717633 CCTGAGGGGTAGACCTGGGCGGG + Exonic
1144968784 17:19094081-19094103 CCTGAGGGGTGCAGCCTGGATGG + Exonic
1144979132 17:19157985-19158007 CCTGAGGGGTGCAGCCTGGATGG - Exonic
1144989090 17:19220247-19220269 CCTGAGGGGTGCAGCCTGGATGG + Exonic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146645245 17:34572897-34572919 CATAAAGGGGAGACCCAGGAAGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152272009 17:79330311-79330333 CAAGAGGGGAAGCCCCTGCATGG - Intronic
1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG + Intronic
1152809934 17:82376511-82376533 ACTGAGGGGTAGGCACTGGAGGG - Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153560127 18:6363278-6363300 CATCAGGGGCTGCCCCTGGACGG - Intronic
1155058815 18:22210413-22210435 CATGTGGGCTACTCCCTGGAAGG - Intergenic
1155332319 18:24730870-24730892 GAGGAAGTGTAGACCCTGGATGG - Intergenic
1158290326 18:55933033-55933055 CATGAGGGGTAGACAGAGGCAGG + Intergenic
1158849300 18:61478632-61478654 CATGAGGAGTAAACAGTGGATGG + Intronic
1159780895 18:72659288-72659310 CATTAGGTGTAGACACTGGAAGG + Intergenic
1161388952 19:4011395-4011417 CATGAGGGGTAGGACCCTGAAGG - Intronic
1161482966 19:4519856-4519878 GAGGAGGGGTAGATCCTGGCTGG - Intergenic
1162172884 19:8805218-8805240 AATGAGAGGTAGAACCTGGCGGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163189818 19:15669556-15669578 CGTGGTGGGTGGACCCTGGATGG + Intergenic
1164615127 19:29663159-29663181 CATGGAGGGTAGGCCCTGGCTGG - Intergenic
1165369883 19:35398494-35398516 AATGATGGGAAGCCCCTGGAGGG - Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166725947 19:45027682-45027704 GATGAGGGGTGGTCCCTTGAGGG + Intronic
1167216156 19:48166496-48166518 CAGGAGGGACAGACGCTGGAGGG + Intronic
1167233769 19:48301716-48301738 ATGGAGGGATAGACCCTGGATGG + Intronic
1167233869 19:48302224-48302246 ATGGAGGGATAGACCCTGGATGG + Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168277712 19:55286421-55286443 CATGAAGAGAAGACCCAGGAAGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
927436424 2:23070460-23070482 CGTGAGGGGGTGACCCTGGCTGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931255394 2:60567743-60567765 CATTAGGGGTTGACACTGGCTGG - Intergenic
931817789 2:65921642-65921664 CAGAAGGGGTAGACTCTGGGGGG + Intergenic
931913951 2:66932808-66932830 CATGGAGGGTAGTCCCAGGAGGG + Intergenic
932285740 2:70530286-70530308 GATGGTGGGCAGACCCTGGAAGG - Intronic
935146919 2:100401961-100401983 GATGAGGGGTGCACTCTGGAAGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
937499622 2:122463665-122463687 TATGAGGGGGAGATACTGGAGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948353711 2:237360724-237360746 CGTTAAGGGTAGTCCCTGGAGGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1172153606 20:32808204-32808226 TCTGAGTGGTAGACCCAGGAAGG - Exonic
1173965452 20:47109138-47109160 CTTCAGGGGGAGACCCTGGATGG - Intronic
1174280729 20:49437305-49437327 GATGGGGGCTGGACCCTGGAGGG + Intronic
1176246561 20:64100031-64100053 CATGAGGGGTGGGGCCTGGCAGG + Exonic
1179418330 21:41216011-41216033 CATGAGGTGAGGAACCTGGAAGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181814770 22:25429785-25429807 CATGAAGGAGAGACCCTGGAAGG - Intergenic
1182479157 22:30595598-30595620 CATCATTGGTGGACCCTGGAGGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183080151 22:35451066-35451088 CATTTGGGGTAGAGCATGGAGGG - Intergenic
1183662491 22:39229887-39229909 CATGAGGATTAGCCCCTGGCTGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184490097 22:44803478-44803500 CAGAAGGTGTAGACCCAGGAGGG - Intronic
949151959 3:779946-779968 CATGAGGGCCAGATCATGGAAGG - Intergenic
949458198 3:4261913-4261935 CATCAAGGGTAGCCCCTGAAAGG - Intronic
949583097 3:5410675-5410697 TATGAAGGGAAGACCTTGGAGGG + Intergenic
951605817 3:24433840-24433862 CATGGGGAAAAGACCCTGGATGG + Intronic
954202165 3:49030089-49030111 AATGATGGATGGACCCTGGAGGG - Exonic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954643845 3:52118634-52118656 CCAGAGGGGCAGACCCTGCATGG - Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960375657 3:116898304-116898326 TAAGAGGGTTAGAGCCTGGAAGG + Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961416985 3:126766552-126766574 CAGGAGGTGAAGACTCTGGATGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969108165 4:4823688-4823710 CAGGAGGTGTGGGCCCTGGAGGG - Intergenic
969411325 4:7030179-7030201 TAGGAGTGGAAGACCCTGGAGGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972542051 4:40047801-40047823 CAGGAGGGGTTGAACCTGGGAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979588653 4:122451001-122451023 CTTGTGGAGTAGACCCAGGATGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
984368342 4:178828106-178828128 CATGAGTGGTACACAGTGGAGGG - Intergenic
984616425 4:181903768-181903790 CAGTAGGGGTAGAACCAGGAGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
989382356 5:40821987-40822009 CATGAGGGGCAGACCCCTCATGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990351269 5:54919116-54919138 CTGGTGGGGTAGACACTGGAGGG - Intergenic
990696489 5:58423615-58423637 AATGAGAGATAGAGCCTGGAGGG + Intergenic
990786263 5:59423973-59423995 CATGAGGGTTGGACCCAAGATGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
994473899 5:100242921-100242943 CATGAGGGGCAGAAGCTAGAAGG + Intergenic
995050766 5:107700266-107700288 CAGGAGGGGTAGGCCCCAGATGG + Intergenic
996557455 5:124793678-124793700 CATGAAGGTTAGCCCCTGTAGGG + Intergenic
997204145 5:132031775-132031797 CATGAGGGGAAGAGGTTGGATGG - Intergenic
999241256 5:150128757-150128779 CATTAGGGGCAAAGCCTGGAGGG - Intronic
1001571865 5:172735403-172735425 CCTGAGGGGTGGGCCCTGGAGGG + Intergenic
1001603614 5:172944847-172944869 CTGGAGGGGGAGACCCTGGATGG - Intronic
1002334778 5:178470237-178470259 CAGGAGGGACAGACGCTGGATGG - Intronic
1004917810 6:20348140-20348162 CATGTGGGATAGATCCTGGTAGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008481459 6:51990145-51990167 CATGAGGGCAATAGCCTGGAGGG - Intronic
1013373103 6:109487413-109487435 GATGAAGAGTAGATCCTGGAGGG + Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1015110326 6:129585705-129585727 CATGAGTGTAAGGCCCTGGAAGG - Intronic
1017092294 6:150770821-150770843 CAAGAGGGCTAGATCCTGGGAGG + Intronic
1018397263 6:163387998-163388020 CATGAAGGGAAGGCCCTGGAAGG + Intergenic
1019158894 6:170056630-170056652 GATGAGGGGGAGACCCGGGGCGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019987449 7:4668134-4668156 CTTGAGGGGCAGACTCTGGAAGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1024629822 7:51237987-51238009 CCTGAGGGGCATGCCCTGGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026501322 7:70945535-70945557 GATGAGGAATAGACCCAGGAAGG - Intergenic
1029261238 7:99304288-99304310 CATGAGGGGCACAGCATGGAGGG - Intergenic
1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034872522 7:154696615-154696637 CATGAGTGGAAGGGCCTGGATGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038653095 8:29423494-29423516 AATGAGGTGCAGATCCTGGAAGG - Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040959214 8:53013221-53013243 CCTCAGGGGTACACCCTTGAAGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045502752 8:102755929-102755951 CATGGGGGGTGGACCCTGACAGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1049173915 8:141179864-141179886 CTTAAGGGGCAGGCCCTGGACGG + Intronic
1049402171 8:142433352-142433374 CATGATGGGGAGACCCTAGTGGG - Intergenic
1049613537 8:143566881-143566903 CATGAGGTGGAGACCCAGGAGGG + Exonic
1049703198 8:144024234-144024256 CATGAGGGAGAGGGCCTGGAGGG - Intronic
1049852479 8:144840415-144840437 CATGTGGGGTAGACTCGGGCTGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051359767 9:16271601-16271623 CGTGAGGAAGAGACCCTGGATGG + Intronic
1053583823 9:39435836-39435858 CATGAGGGGTGGAGCATGGCGGG - Intergenic
1054105404 9:60994580-60994602 CATGAGGGGTGGAGCATGGCGGG - Intergenic
1056578322 9:87872377-87872399 CTGGAGGGGTAGAGCCTGGCTGG - Intergenic
1057438461 9:95063817-95063839 CATGAGGGCCAGACCCTGAAGGG - Intronic
1060130554 9:121093802-121093824 CTTGAGGGGAAGATCCAGGAGGG + Intronic
1062480369 9:136748209-136748231 CAGGAGGGGTGGATGCTGGAGGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192552299 X:72064213-72064235 TATGAGGGGTAGCCGCTGGCAGG + Intergenic
1199792950 X:151171940-151171962 CAGGAGGGGCAGGGCCTGGATGG + Intergenic