ID: 1152771904

View in Genome Browser
Species Human (GRCh38)
Location 17:82175207-82175229
Sequence CATGAGGGGTAGACCCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152771897_1152771904 14 Left 1152771897 17:82175170-82175192 CCAAAAGGAAGAAAGAATTCTCC 0: 1
1: 0
2: 8
3: 60
4: 555
Right 1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 242
1152771899_1152771904 -7 Left 1152771899 17:82175191-82175213 CCTGGAGAAACAGTCGCATGAGG 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152771904 Original CRISPR CATGAGGGGTAGACCCTGGA AGG Intronic