ID: 1152772612

View in Genome Browser
Species Human (GRCh38)
Location 17:82179549-82179571
Sequence GGTGGACCCAGCCACGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152772612 Original CRISPR GGTGGACCCAGCCACGGGGT GGG Intronic
900177011 1:1295414-1295436 GGTGGGCCCAGCCAGGTGGCAGG - Intronic
900563939 1:3323231-3323253 GGTGGGGGCAGCCACGAGGTGGG + Intronic
901067207 1:6499919-6499941 GGTGGTCCCAGCTACTCGGTAGG - Intronic
902179643 1:14678182-14678204 GGAAGACCCACCCACAGGGTGGG + Intronic
902271744 1:15309896-15309918 GCTGGACCAAGCCACGGTGTTGG + Intronic
903471207 1:23588663-23588685 GATGGAGCCAGCCACAGGGCTGG - Intronic
903774210 1:25782452-25782474 GGAGTCCCCAGCCAAGGGGTGGG + Intronic
905083012 1:35342274-35342296 TGTGGTCCCAGCTACGGGGGAGG - Intronic
905119638 1:35671895-35671917 TGTGGTCCCAGCCACTGGGGAGG - Intergenic
907037725 1:51230940-51230962 TGTGGTCCCAGCCACGTGGGAGG + Intergenic
907540890 1:55214914-55214936 GGTGGCCCCAGCCCCGGGCCCGG - Exonic
908264019 1:62360995-62361017 TGTGGTCCCAGCCACTGGGGAGG + Intergenic
914757247 1:150570353-150570375 TGTGGTCCCAGCCACTGGGGAGG - Intergenic
915355852 1:155254988-155255010 AGGGGACCCAGCCAGGGGGTGGG - Exonic
915391257 1:155546207-155546229 TGTGGTCCCAGCTACGTGGTAGG + Intronic
917519302 1:175734812-175734834 TCTGGAGCCAGCCATGGGGTGGG - Intronic
918714905 1:187773327-187773349 GGAAGACCCACCCACGGTGTGGG - Intergenic
918985350 1:191617858-191617880 CGTGTACCCAGTCACTGGGTGGG - Intergenic
924560386 1:245153779-245153801 GGGAGACCCAGCCCGGGGGTGGG - Intergenic
1062777798 10:168912-168934 GAGGGACCCAGTCACGGGGGAGG + Intronic
1065862010 10:29879703-29879725 AGTGGAGCCAGCCACTGTGTAGG - Intergenic
1067094387 10:43289196-43289218 TGTGGTCCCAGCCACTTGGTAGG + Intergenic
1069547275 10:69337823-69337845 TGTGCACCCTTCCACGGGGTGGG + Intronic
1070102611 10:73402319-73402341 TGTGGTCCCAGCTACGGGGTGGG - Intronic
1076662387 10:132064406-132064428 GGAGGAGCCACCCTCGGGGTCGG + Intergenic
1076815768 10:132914024-132914046 GCTGGACACAGCCTCGGGGCGGG - Intronic
1076815795 10:132914123-132914145 GCTGGACACAGCCTCGGGGCGGG - Intronic
1076815876 10:132914420-132914442 GCTGGACACAGCCTCGGGGCGGG - Intronic
1076815885 10:132914453-132914475 GCTGGACACAGCCTCGGGGCGGG - Intronic
1076815921 10:132914585-132914607 GCTGGACACAGCCTCGGGGCGGG - Intronic
1078414863 11:11156741-11156763 CGTGGACCCAGCCCAGGGGAGGG - Intergenic
1080643148 11:34169734-34169756 CGTGGACCCAGGCCAGGGGTTGG - Intronic
1081510776 11:43770612-43770634 TGTGGTCCCAGCCACTGGGGAGG + Intronic
1081842808 11:46215533-46215555 GGTGGTCCCAGCTACTGGGGAGG - Intergenic
1083609824 11:63999471-63999493 GGTGGACCCAGACGCCGGGAGGG - Intronic
1083963156 11:66025722-66025744 GGTGGGGCCAGCCACGGTGGGGG + Exonic
1088319853 11:108544309-108544331 GGTGGTCCCAGCTACTGGGGAGG - Intronic
1090496096 11:127214215-127214237 GGTGGGCCAAGCCATGCGGTAGG - Intergenic
1202828158 11_KI270721v1_random:99791-99813 GGTGGAGCTCGCCACGGGGGGGG + Intergenic
1092026557 12:5245638-5245660 GGTGGACCCAGCTACTTGGGAGG - Intergenic
1095984672 12:47991420-47991442 GCAGGCCCCAGACACGGGGTAGG - Intronic
1097188416 12:57208199-57208221 GGTGGACCCACTGAGGGGGTGGG + Exonic
1099032197 12:77540295-77540317 GGTGGTGCTAGCCACTGGGTTGG + Intergenic
1101771982 12:107760689-107760711 CGTGCACCCCGCCACGGGTTGGG + Exonic
1102312553 12:111858018-111858040 TGTGGTCCCAGCTACTGGGTAGG - Intronic
1104006406 12:124895876-124895898 TGTGGTCCCAGCCACTGGGGAGG + Intergenic
1106411656 13:29515134-29515156 GGTGGCCCCAGCCCCTGGGCAGG - Intronic
1108996992 13:56747104-56747126 GGTGGACCCATCTAGGGGCTAGG - Intergenic
1110082398 13:71331941-71331963 AGGGGACCCAGTCATGGGGTTGG + Intergenic
1113470138 13:110538482-110538504 TGTGGTCCCAGCTACTGGGTAGG + Intronic
1113559746 13:111269151-111269173 TGTGGACACAGCCCAGGGGTAGG - Intronic
1113961217 13:114127314-114127336 GGTGGACTCAGCCAGGGTGCTGG - Intronic
1114537204 14:23430528-23430550 TGAGGACCCAGCCAGGGGGTGGG - Intronic
1115729405 14:36252160-36252182 TGTGGTCCCAGCTACGGGGGAGG - Intergenic
1115969412 14:38928768-38928790 GGTGGATACAGACACGGGGCTGG + Intergenic
1116378924 14:44240197-44240219 GGGGGACTCAGTCACGGGGGAGG + Intergenic
1116614649 14:47119185-47119207 TGTAGTCCCAGCTACGGGGTGGG - Intronic
1116902901 14:50378653-50378675 TGTGGTCCCAGCCACTGGGGAGG - Intronic
1118316110 14:64727107-64727129 GGAGGACACAGCCATGGGGTAGG + Intronic
1119328834 14:73778745-73778767 GGTTGACCCAGCCCTGGTGTGGG - Intronic
1119559556 14:75579149-75579171 GGTGAGCCAAGCCACTGGGTTGG - Exonic
1121990708 14:98554044-98554066 GGTCAACCCAGCCACGGAATAGG + Intergenic
1122107639 14:99470582-99470604 GGTAGACCCAGCCAGTGGGGAGG - Intronic
1122317630 14:100835348-100835370 GCTGGACCAAGCCCCGGGGGAGG - Intergenic
1122399504 14:101458552-101458574 GCGGGGCCCAGCCACGGGGGCGG + Intergenic
1123701269 15:22916367-22916389 GGTGCACCAAGGGACGGGGTAGG + Intronic
1124645704 15:31436416-31436438 GATGGGCCGAGCCACGGGCTGGG - Intergenic
1124944053 15:34246766-34246788 TGTGGTCCCAGCCACGTGGGAGG - Intronic
1126458907 15:48894906-48894928 AGTGGTCCCAGCCACAGGGGAGG - Intronic
1127447692 15:59081901-59081923 TGTGGTCCCAGCTACTGGGTAGG + Intronic
1129367160 15:75063308-75063330 TGTGGTCCCAGCTACGGGGGAGG - Intronic
1132582796 16:693275-693297 AGTGGACCCAGCCAAGGGTCAGG - Exonic
1132724428 16:1332757-1332779 GGTGGTCCCAGCTACTGGGGAGG + Intergenic
1132796191 16:1724383-1724405 GGTGGCCACAGCCACGTGGCGGG + Intronic
1132942057 16:2513378-2513400 GGTGACCGCAGCCACGGGCTGGG + Intronic
1136082951 16:27864853-27864875 GGTGGACCCACACATGGGCTGGG - Intronic
1136136392 16:28259145-28259167 GGGGGTTCCAGCCACGGGGCTGG - Intergenic
1136478435 16:30526915-30526937 GAGGGGCCCGGCCACGGGGTGGG + Intronic
1137666472 16:50252421-50252443 GGTGGAGGCAGCCACTGGGTAGG + Intronic
1139596001 16:67958670-67958692 GGTGGCCCAAGCCAAGGAGTTGG - Intronic
1139913076 16:70410370-70410392 TGTGGTCCCAGCTACGGGGGAGG - Intronic
1142033862 16:87851932-87851954 GGTGGACCTGGCCCTGGGGTGGG - Intronic
1142064055 16:88050276-88050298 TGTGGTCCCAGCCACCGGGGAGG - Intronic
1143127914 17:4656480-4656502 GCGGGACCCACCCACCGGGTGGG - Intergenic
1144512218 17:15886935-15886957 AGTGGACCCAGCCAGGGGGCAGG + Intergenic
1144749686 17:17639806-17639828 TGTGGTCCCAGCCACTGGGGAGG + Intergenic
1145123596 17:20282037-20282059 AGTGGACCCAGCCAGGGGGCAGG + Intronic
1145943952 17:28759328-28759350 GGTGGACCAAGCCCTGGGTTTGG + Exonic
1147115318 17:38294913-38294935 GGTGGCCCCAGCTACTGGGGAGG - Intergenic
1147135193 17:38430025-38430047 GGTGGACCCAACCACACTGTGGG - Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148414361 17:47494679-47494701 GGTGGCCCCAGCTACTGGGGAGG + Intergenic
1149965127 17:61154555-61154577 TGTGGTCCCAGCCACTGGGGTGG - Intronic
1151796987 17:76353292-76353314 CGCGGACCCAGTCACGGGGCGGG + Intronic
1152007770 17:77693352-77693374 GTTGGTCCCAGCCCTGGGGTGGG - Intergenic
1152517532 17:80834553-80834575 CTTGGATCCAGCCCCGGGGTGGG - Intronic
1152772612 17:82179549-82179571 GGTGGACCCAGCCACGGGGTGGG + Intronic
1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG + Intronic
1153926954 18:9842781-9842803 GGTGGACAGAGTCACGGGTTTGG + Intronic
1154490319 18:14917122-14917144 GGAGGACGCAGCCAGGGGGAGGG - Intergenic
1155436576 18:25818808-25818830 GATGGCCCCAGCCAGAGGGTAGG + Intergenic
1157073501 18:44438069-44438091 GGAGGACACAGTCATGGGGTGGG - Intergenic
1158313638 18:56186727-56186749 GTTAGACCCAGCCAATGGGTAGG - Intergenic
1159954100 18:74507391-74507413 GCAGGACCCAGCCACGGAGTGGG - Intronic
1160119970 18:76121648-76121670 GGTGGACCCAGCCATCTGCTGGG + Intergenic
1160139865 18:76311813-76311835 GTGGGACCCAGTCATGGGGTTGG + Intergenic
1160450896 18:78965389-78965411 GTTGGTCCCAGGCAGGGGGTGGG - Intergenic
1160740985 19:685740-685762 GGTGGTCCCAGGCAGGGGGCCGG + Exonic
1163748117 19:19059978-19060000 GGAGGAGCCGGCCACGGGGAAGG - Intronic
1163772558 19:19199588-19199610 GGTGGGCCCAGCCCTGGGATGGG + Intronic
1164245363 19:23423513-23423535 GGTGGTCCCAGCTACTGGGGAGG - Intergenic
1165389338 19:35529425-35529447 GGTTGAGGCAGCCACGGGGAGGG + Intergenic
1167590853 19:50403482-50403504 GGTGGACCAGGCCTGGGGGTGGG - Exonic
1168146735 19:54423775-54423797 GGAGGACGCAGCCACGTGGCAGG - Intronic
1168693758 19:58393516-58393538 GGTGGACACAGCCACGGGAGTGG + Intronic
926688741 2:15718281-15718303 GCTGGGGCCAGCCTCGGGGTTGG + Intronic
927065266 2:19464705-19464727 GGTGAGCCCAGCCAAAGGGTTGG + Intergenic
929688303 2:44053581-44053603 TGTGGACCCAGCTACTGGGGAGG + Intergenic
931794162 2:65693452-65693474 AGTGGGCCCAGCCACAGGGAGGG + Intergenic
933811135 2:86033428-86033450 GGTGTAGCCAGCCCCGGGGCAGG - Intronic
934790964 2:97059804-97059826 GCTGGGCACAGCCACGGGGCTGG - Intergenic
934815485 2:97322726-97322748 GCTGGGCACAGCCACGGGGCTGG + Intergenic
934822210 2:97385757-97385779 GCTGGGCACAGCCACGGGGCTGG - Intergenic
934856958 2:97735467-97735489 GGTGGGCCCGGCCATCGGGTGGG + Intronic
935718596 2:105960238-105960260 GGTGGACTCAGGCAGGAGGTAGG - Intergenic
937234530 2:120422676-120422698 GGTGGACACAGCCTCAGGGTAGG + Intergenic
937913800 2:127089180-127089202 GATGGACCCAGGCCTGGGGTTGG - Intronic
943184363 2:184587566-184587588 TGTGGACCCAGCTACTGGGGAGG + Intergenic
944615325 2:201453042-201453064 GCTGCACCCAGCAAAGGGGTGGG - Intronic
946374432 2:219299534-219299556 GGTGGGGCCAGCAACGGGCTGGG + Intronic
948526524 2:238574172-238574194 TGTGTAGCCAGCCAGGGGGTAGG - Intergenic
949027974 2:241775142-241775164 GGTGGTCCCAGCCCCAGGCTGGG - Intergenic
1168811972 20:710275-710297 GATGGACCGAGCCAAGGGGCGGG - Intergenic
1169478584 20:5955898-5955920 GGTGCACCCAGCCACTCGGGAGG - Intronic
1169807410 20:9573756-9573778 TGTGGACACAGCCACAGTGTGGG + Intronic
1170040591 20:12035635-12035657 GGGTGAACCAGCCATGGGGTCGG + Intergenic
1170570148 20:17628066-17628088 GGGGGACCCAGCCAGGGAGGTGG - Intronic
1171191024 20:23159573-23159595 GGTGGAGCCAGCCTGGGGGTGGG + Intergenic
1172613375 20:36267537-36267559 GGTGGGTCCTGCCACTGGGTAGG + Intronic
1173367356 20:42399028-42399050 GGTGGCCCCAGACACTGGGAGGG + Intronic
1173667890 20:44775583-44775605 GGTGGCCCCAGCCCCGCTGTGGG - Intronic
1174377133 20:50133544-50133566 GGTGGACCCAGGCCAGGGGCAGG + Intronic
1176042855 20:63074414-63074436 TGTGGACCCAGCCACTTGGGAGG + Intergenic
1176155445 20:63617812-63617834 GGTGGAAGCAGCCTCGGGGTAGG - Intronic
1178423587 21:32461187-32461209 GGCGCAGCCAGCCACAGGGTAGG + Intronic
1179995422 21:44971780-44971802 GGTGGACACAGGGAGGGGGTCGG + Intronic
1181000799 22:19987030-19987052 GGGGGACCCTGGCCCGGGGTCGG - Intronic
1181321604 22:22011387-22011409 GGGGGACCCAGCTATTGGGTGGG + Intergenic
1182069965 22:27456531-27456553 GGTGGTCCCAGCTACTGGGGAGG + Intergenic
1183055276 22:35301103-35301125 TGTGCACCCAGCCACTCGGTAGG + Intronic
1183428310 22:37751264-37751286 GGTGGAGCCAGTCACAGGCTGGG - Intronic
1184298862 22:43543310-43543332 GGGGGACCCAGCCACCAGGGCGG + Intronic
1184442148 22:44523465-44523487 GGTGGTGCCAGCCACGGAGATGG + Intergenic
1184890909 22:47378526-47378548 GGTGGACCCAGGGAGGGGGAGGG + Intergenic
1185020772 22:48373642-48373664 TGGGAACCCAGCCACGGGGCTGG + Intergenic
1185380390 22:50505132-50505154 GGTGGACCCAGGTGCGGGGCTGG - Exonic
954429594 3:50463418-50463440 TGTGGTCCCAGCCACTGGGGAGG - Intronic
956741696 3:72280561-72280583 GGTGGTCCCAGCTACTGGGGAGG - Intergenic
956823216 3:72972801-72972823 GGTAGTCCCAGCTACTGGGTGGG + Intronic
959882019 3:111454752-111454774 TGTGGTCCCTGCCACGGGCTTGG + Intronic
961324806 3:126103736-126103758 GGGGGCCCCAGCCACGAGGGAGG + Exonic
962095898 3:132292471-132292493 GGTGGACCCAGCTGCTGGGGAGG - Intergenic
968481750 4:836131-836153 GGGGGAGGCAGCCACGGGGGAGG + Intergenic
968517523 4:1021149-1021171 TGGGGACCCAGACAGGGGGTGGG + Intronic
968656096 4:1779066-1779088 GGGAGACCCAGGCACGAGGTAGG - Intergenic
969170185 4:5356063-5356085 GGTGGTCACAGCCAGGGTGTGGG - Intronic
969175408 4:5395142-5395164 TGTGGAGCCAGCCACACGGTGGG - Intronic
969517178 4:7654320-7654342 TGGGGACCCAGCCCCGGGATGGG - Intronic
972385243 4:38559653-38559675 AGGGGACCCAGCACCGGGGTTGG - Intergenic
975401565 4:73944527-73944549 GCTGGCCCCACCCCCGGGGTGGG + Intergenic
975492332 4:75002788-75002810 GGTGGACCCAGCCGCAGCTTTGG + Intronic
986009391 5:3698570-3698592 GGTGTACCCAGCCTCAGAGTGGG + Intergenic
986780892 5:11064654-11064676 GGTAGACCCAGGCATGAGGTAGG - Intronic
996065772 5:119077590-119077612 TGTGGTCCCAGCCACGTGGGAGG - Intronic
1001550525 5:172599043-172599065 GGAGATCCCAGCCACGGGCTAGG + Intergenic
1002384362 5:178855236-178855258 GGAGGACCCAGGTACTGGGTGGG - Intergenic
1002773008 6:305232-305254 GGTGCACCCAGCAAGGGGCTTGG - Intronic
1005389768 6:25321236-25321258 TGAGCACCCACCCACGGGGTTGG + Intronic
1005987249 6:30882908-30882930 GGTGGGGCCAGCCTGGGGGTGGG - Intronic
1006370915 6:33643126-33643148 GTGGGACCCAGCAAGGGGGTGGG + Intronic
1007236388 6:40393693-40393715 GCTGGAGCAAGCCTCGGGGTGGG - Intronic
1007368736 6:41412661-41412683 GGTGGACTGAGACAGGGGGTAGG - Intergenic
1010615056 6:78002443-78002465 TGTGGTCCCAGCTACTGGGTAGG + Intergenic
1010691663 6:78918173-78918195 GGTGGTCCCAGCCACTTGGGAGG + Intronic
1016993892 6:149947535-149947557 GAAGGTCCCAGCCACGGGGAGGG - Intronic
1017004441 6:150020002-150020024 GAAGGTCCCAGCCACGGGGAGGG + Intronic
1019562462 7:1665568-1665590 GTTGGAGCCAGCCGCGGGGGCGG - Intergenic
1020101208 7:5395212-5395234 GGTGGTGCCAGCCATGGGCTGGG - Intronic
1020173996 7:5867868-5867890 GGTGGTCCCAGCTACCGGGGAGG - Intergenic
1021132896 7:16932990-16933012 TGTGGACCCAGCCACTTGGGAGG - Intergenic
1021219664 7:17961486-17961508 TGTGGTCCCAGCTACGGGGGAGG + Intergenic
1024268018 7:47621501-47621523 AGTGGAGCCAGCCAGGGTGTGGG + Intergenic
1026797554 7:73376175-73376197 TGTGGTCCCAGCTACGGGGGAGG - Intergenic
1026827630 7:73594224-73594246 GAGGGACCCAGCCTCGGGGGTGG - Intronic
1026969752 7:74460834-74460856 GGGAGACCCCGCCACGGGGGCGG + Intronic
1029422212 7:100477575-100477597 GGTGGACGGAGCCAGGAGGTGGG + Exonic
1031969686 7:128055168-128055190 GGTAGATCCAGTCAGGGGGTTGG + Intronic
1032456269 7:132075570-132075592 GGTGGACTCTGGCAGGGGGTGGG + Intergenic
1033045044 7:137954385-137954407 GGTGGACCCAGGCAGGGGGCAGG + Intronic
1034353589 7:150433299-150433321 GGTGGCTCCAGCCACCGTGTTGG + Intergenic
1037281565 8:17247279-17247301 GGGGGACCCAGCCGCGGAGGAGG - Exonic
1037393607 8:18419745-18419767 GGTGGAGATCGCCACGGGGTGGG + Intergenic
1038706629 8:29899993-29900015 CATGGACCTAGGCACGGGGTGGG - Intergenic
1040644448 8:49382094-49382116 GGTGCACCTGGCCACGGGGAGGG - Intergenic
1042878068 8:73457925-73457947 GAGGGACCTAGGCACGGGGTTGG + Intronic
1049008764 8:139873702-139873724 GGTGGAAGCAGCCAGGGGCTGGG + Intronic
1049069557 8:140345978-140346000 GCTGGACACAGCCCTGGGGTTGG + Intronic
1050251605 9:3750454-3750476 TGTGGTCCCAGCCACTGGGGAGG - Intergenic
1050725617 9:8644740-8644762 GTTGGCCGCTGCCACGGGGTGGG - Intronic
1059347677 9:113641055-113641077 TGTGGACCCAGGCCAGGGGTGGG - Intergenic
1059551963 9:115237909-115237931 GCTGCACACAGCCAGGGGGTTGG - Intronic
1059925051 9:119201000-119201022 GTGGAACCCAGCCAAGGGGTAGG + Intronic
1060251120 9:121987511-121987533 GGTGGACTCAGCCAGAGTGTGGG - Intronic
1060601780 9:124882848-124882870 GGTGGACCAAGCCCCCGGGAAGG - Intronic
1061473273 9:130844241-130844263 GGGGGACCCAGCCAAGGGCGTGG + Intronic
1061853565 9:133429479-133429501 GGTGGGCCCAGGAACGGGGTGGG - Intronic
1061887323 9:133598299-133598321 GGTGGAACAAGGCACAGGGTGGG + Intergenic
1062412169 9:136431110-136431132 GATGGACCCTGCCACAGGATGGG + Exonic
1062476179 9:136728534-136728556 GGTGGTCCCAGCCATTGGGGCGG + Intergenic
1185737449 X:2504005-2504027 GTTGCACCCAGCCACTGGGTGGG + Intergenic
1189300912 X:39951665-39951687 GGTGGGCCCTGCCAGGGGCTGGG + Intergenic
1189538116 X:41957430-41957452 GGTGTCCCCAGCCCCGGGCTGGG - Intergenic
1192139960 X:68638843-68638865 GGGGGACCGAGAAACGGGGTGGG - Intergenic
1192188489 X:68974985-68975007 GGGAGACCCAGCCATGGGTTGGG - Intergenic
1193599566 X:83493716-83493738 GGGGTACCCAGCCACTGGGCTGG + Intergenic
1194987970 X:100511885-100511907 TGTGTACCCAGCCAAGGGTTAGG + Intergenic
1200076307 X:153553019-153553041 GGTGCACCTAGGCAGGGGGTGGG - Exonic