ID: 1152772631

View in Genome Browser
Species Human (GRCh38)
Location 17:82179609-82179631
Sequence GGTGGACCCAGCCACGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 279}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152772621_1152772631 -1 Left 1152772621 17:82179587-82179609 CCCCAGAGCAAGTGCAGAGCAGG 0: 1
1: 0
2: 2
3: 50
4: 326
Right 1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG 0: 1
1: 1
2: 3
3: 27
4: 279
1152772619_1152772631 26 Left 1152772619 17:82179560-82179582 CCACGGGGTGGGCAGGGCTGGGA 0: 2
1: 0
2: 7
3: 102
4: 631
Right 1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG 0: 1
1: 1
2: 3
3: 27
4: 279
1152772625_1152772631 -3 Left 1152772625 17:82179589-82179611 CCAGAGCAAGTGCAGAGCAGGGT 0: 1
1: 0
2: 3
3: 25
4: 235
Right 1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG 0: 1
1: 1
2: 3
3: 27
4: 279
1152772620_1152772631 0 Left 1152772620 17:82179586-82179608 CCCCCAGAGCAAGTGCAGAGCAG 0: 1
1: 0
2: 1
3: 22
4: 209
Right 1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG 0: 1
1: 1
2: 3
3: 27
4: 279
1152772616_1152772631 30 Left 1152772616 17:82179556-82179578 CCAGCCACGGGGTGGGCAGGGCT 0: 1
1: 0
2: 0
3: 24
4: 377
Right 1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG 0: 1
1: 1
2: 3
3: 27
4: 279
1152772623_1152772631 -2 Left 1152772623 17:82179588-82179610 CCCAGAGCAAGTGCAGAGCAGGG 0: 1
1: 0
2: 4
3: 32
4: 341
Right 1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG 0: 1
1: 1
2: 3
3: 27
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152772631 Original CRISPR GGTGGACCCAGCCACGGGGC GGG Intronic
900177011 1:1295414-1295436 GGTGGGCCCAGCCAGGTGGCAGG - Intronic
900180524 1:1309061-1309083 GCAGGACCGAGCCGCGGGGCGGG - Intronic
900302929 1:1986911-1986933 GGTGGCCCTCGCCAGGGGGCAGG - Intronic
900487843 1:2931907-2931929 GGAGGACTCAGGGACGGGGCGGG - Intergenic
900745107 1:4355737-4355759 TGTGGAGCCTGACACGGGGCAGG + Intergenic
901131047 1:6962716-6962738 GATGGGGCCAGCCATGGGGCAGG - Intronic
901813357 1:11779942-11779964 GGTGGGCCCAGGAGCGGGGCTGG + Exonic
902082739 1:13832448-13832470 GGTGGAGCGAGCCACTGGTCTGG + Intergenic
902092611 1:13915562-13915584 GGTGCACACAGCCCCAGGGCTGG - Intergenic
902271744 1:15309896-15309918 GCTGGACCAAGCCACGGTGTTGG + Intronic
902501414 1:16914058-16914080 GGGCGTCCCCGCCACGGGGCGGG - Intronic
903471207 1:23588663-23588685 GATGGAGCCAGCCACAGGGCTGG - Intronic
904006234 1:27364733-27364755 GGTGGAGGCAGGCACAGGGCTGG - Intronic
904446078 1:30573899-30573921 GGTGGAGCCAGCCAGGCAGCCGG - Intergenic
905043237 1:34977103-34977125 GGTGGCCCCGGCCGCGTGGCAGG + Intergenic
905083012 1:35342274-35342296 TGTGGTCCCAGCTACGGGGGAGG - Intronic
905119638 1:35671895-35671917 TGTGGTCCCAGCCACTGGGGAGG - Intergenic
907037725 1:51230940-51230962 TGTGGTCCCAGCCACGTGGGAGG + Intergenic
907540890 1:55214914-55214936 GGTGGCCCCAGCCCCGGGCCCGG - Exonic
908264019 1:62360995-62361017 TGTGGTCCCAGCCACTGGGGAGG + Intergenic
908523520 1:64966572-64966594 GGTGGGGCCGGCCGCGGGGCGGG - Intergenic
913139386 1:115925573-115925595 GGGGGGCCCTGCCACAGGGCTGG - Intergenic
913322319 1:117597606-117597628 TGAGGACCCAGCCCTGGGGCTGG + Intergenic
914757247 1:150570353-150570375 TGTGGTCCCAGCCACTGGGGAGG - Intergenic
915355852 1:155254988-155255010 AGGGGACCCAGCCAGGGGGTGGG - Exonic
915461305 1:156072268-156072290 GGTGGAGACAGCCCTGGGGCAGG - Exonic
915538784 1:156554263-156554285 GGTGAACCCTGCCACAGGCCTGG - Exonic
924775172 1:247111360-247111382 GGTGGAGAGAGCCGCGGGGCAGG + Exonic
1062777798 10:168912-168934 GAGGGACCCAGTCACGGGGGAGG + Intronic
1062958071 10:1553069-1553091 GGTGCTCCCAGCAATGGGGCAGG - Intronic
1065122599 10:22543790-22543812 GGTGAAGCCAGCCAGGGAGCTGG + Intronic
1070102611 10:73402319-73402341 TGTGGTCCCAGCTACGGGGTGGG - Intronic
1073105418 10:101029965-101029987 GCGGGACCCAGCCACTGGCCTGG - Intronic
1073486823 10:103824415-103824437 GGTTGACCCAGCCTCTGTGCTGG - Intronic
1076250753 10:128982299-128982321 GATGGACACAGCCATGGTGCAGG + Intergenic
1076345677 10:129777487-129777509 GGAGAACACAGCCACGGAGCTGG - Intergenic
1076776363 10:132700116-132700138 GTTGGACCCAGGCTGGGGGCTGG - Intronic
1076815768 10:132914024-132914046 GCTGGACACAGCCTCGGGGCGGG - Intronic
1076815778 10:132914057-132914079 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815787 10:132914090-132914112 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815795 10:132914123-132914145 GCTGGACACAGCCTCGGGGCGGG - Intronic
1076815805 10:132914156-132914178 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815814 10:132914189-132914211 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815823 10:132914222-132914244 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815832 10:132914255-132914277 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815841 10:132914288-132914310 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815850 10:132914321-132914343 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815859 10:132914354-132914376 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815868 10:132914387-132914409 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815876 10:132914420-132914442 GCTGGACACAGCCTCGGGGCGGG - Intronic
1076815885 10:132914453-132914475 GCTGGACACAGCCTCGGGGCGGG - Intronic
1076815895 10:132914486-132914508 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815904 10:132914519-132914541 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815913 10:132914552-132914574 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815921 10:132914585-132914607 GCTGGACACAGCCTCGGGGCGGG - Intronic
1076815931 10:132914618-132914640 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815940 10:132914651-132914673 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815949 10:132914684-132914706 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815958 10:132914717-132914739 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815967 10:132914750-132914772 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815976 10:132914783-132914805 GCTGGACACAGCCTCGGGCCGGG - Intronic
1076815985 10:132914816-132914838 GCTGGACACAGCCTCGGGCCGGG - Intronic
1077184632 11:1230684-1230706 GGGGGACCTGGCCTCGGGGCTGG - Intronic
1078414863 11:11156741-11156763 CGTGGACCCAGCCCAGGGGAGGG - Intergenic
1078509752 11:11976597-11976619 CGGGGCCCCAGCCAGGGGGCAGG + Intronic
1080272538 11:30466391-30466413 GCTGCACCCTGCCATGGGGCTGG + Intronic
1081510776 11:43770612-43770634 TGTGGTCCCAGCCACTGGGGAGG + Intronic
1081842808 11:46215533-46215555 GGTGGTCCCAGCTACTGGGGAGG - Intergenic
1083307398 11:61768550-61768572 TGTGGACACAGCCCTGGGGCTGG - Intronic
1083609824 11:63999471-63999493 GGTGGACCCAGACGCCGGGAGGG - Intronic
1083652511 11:64211499-64211521 GGTGGGCACAGACACGGGACAGG - Intronic
1083963156 11:66025722-66025744 GGTGGGGCCAGCCACGGTGGGGG + Exonic
1084192101 11:67504020-67504042 GCCGGTCCCAGCCCCGGGGCAGG + Intronic
1084679563 11:70658813-70658835 GGTGGTCCCTGCCATTGGGCTGG - Intronic
1085399697 11:76228411-76228433 GATGGAGCCAGGCACTGGGCAGG + Intergenic
1085618872 11:78022705-78022727 TGAAGACCCAGCCAAGGGGCAGG + Intronic
1088319853 11:108544309-108544331 GGTGGTCCCAGCTACTGGGGAGG - Intronic
1088814236 11:113410496-113410518 GGGGGGCCCAGCCCCAGGGCTGG + Exonic
1089169641 11:116503068-116503090 TGTGGGACCAGGCACGGGGCAGG - Intergenic
1091231105 11:133988562-133988584 CGTGAACCCAGCCTCCGGGCTGG - Intergenic
1202828158 11_KI270721v1_random:99791-99813 GGTGGAGCTCGCCACGGGGGGGG + Intergenic
1091700774 12:2660135-2660157 GGTGGACACAACCACAGGTCAGG - Intronic
1092026557 12:5245638-5245660 GGTGGACCCAGCTACTTGGGAGG - Intergenic
1092670197 12:10853606-10853628 GTTGGACCCAGCAAAGTGGCAGG + Intronic
1094149804 12:27270327-27270349 GGTAGACCCAGCTACTTGGCAGG - Intronic
1096477143 12:51915185-51915207 GGGTGACTCAGCCAAGGGGCTGG - Intronic
1097435537 12:59549082-59549104 GGTGGAGCCCACCACAGGGCAGG - Intergenic
1101085219 12:101228669-101228691 GGCAGACCCAGCCATGGGTCAGG + Intergenic
1102213003 12:111140525-111140547 GATGCACCCAGCCACGAAGCTGG - Intronic
1102482304 12:113232298-113232320 GGGGGCCCCTGCCAGGGGGCAGG - Intronic
1103527569 12:121578545-121578567 GGTGGGCAGAGCCAGGGGGCCGG - Intronic
1103725669 12:122996352-122996374 GGTGGACACAGCCTGGGGCCAGG + Intronic
1104006406 12:124895876-124895898 TGTGGTCCCAGCCACTGGGGAGG + Intergenic
1104755575 12:131267205-131267227 GCTGGAGAAAGCCACGGGGCGGG - Intergenic
1106208761 13:27621812-27621834 GCAGGGCCCAGCCGCGGGGCGGG - Exonic
1106411656 13:29515134-29515156 GGTGGCCCCAGCCCCTGGGCAGG - Intronic
1106498651 13:30306902-30306924 GGCGGGCCCAGCTACAGGGCGGG + Intronic
1108637540 13:52350880-52350902 TGTGGTCCCAGCTACTGGGCAGG - Intergenic
1113649933 13:112027890-112027912 CATGGACCCAGCCAGGAGGCAGG + Intergenic
1113961217 13:114127314-114127336 GGTGGACTCAGCCAGGGTGCTGG - Intronic
1114537204 14:23430528-23430550 TGAGGACCCAGCCAGGGGGTGGG - Intronic
1115207231 14:30922006-30922028 TGTGGTCCCAGCTACTGGGCAGG - Intronic
1115729405 14:36252160-36252182 TGTGGTCCCAGCTACGGGGGAGG - Intergenic
1115969412 14:38928768-38928790 GGTGGATACAGACACGGGGCTGG + Intergenic
1116378924 14:44240197-44240219 GGGGGACTCAGTCACGGGGGAGG + Intergenic
1116902901 14:50378653-50378675 TGTGGTCCCAGCCACTGGGGAGG - Intronic
1116999778 14:51360784-51360806 GGTGGACACATCCGCTGGGCAGG - Intergenic
1117601843 14:57384162-57384184 TGTGGTCCCAGCTACGGAGCAGG + Intergenic
1118316110 14:64727107-64727129 GGAGGACACAGCCATGGGGTAGG + Intronic
1119219359 14:72893579-72893601 AGCGGACCCAGCGGCGGGGCGGG + Intronic
1122107639 14:99470582-99470604 GGTAGACCCAGCCAGTGGGGAGG - Intronic
1122317630 14:100835348-100835370 GCTGGACCAAGCCCCGGGGGAGG - Intergenic
1122399504 14:101458552-101458574 GCGGGGCCCAGCCACGGGGGCGG + Intergenic
1122781779 14:104146819-104146841 CGTGGAGACCGCCACGGGGCAGG + Intronic
1123018803 14:105387986-105388008 TGTGGACACAGCCAGGGTGCTGG + Intronic
1124567898 15:30833328-30833350 GGTGGAGGCAGCCACGTGTCCGG + Intergenic
1124944053 15:34246766-34246788 TGTGGTCCCAGCCACGTGGGAGG - Intronic
1126102820 15:45129925-45129947 GCTCGGCTCAGCCACGGGGCGGG - Exonic
1126458907 15:48894906-48894928 AGTGGTCCCAGCCACAGGGGAGG - Intronic
1127020744 15:54745723-54745745 TGTGGACCCATCCACAGTGCAGG - Intergenic
1129367160 15:75063308-75063330 TGTGGTCCCAGCTACGGGGGAGG - Intronic
1130898839 15:88192026-88192048 GGTGGCCCCAGATGCGGGGCTGG - Intronic
1132368692 15:101277541-101277563 GTTTGGCCCAGCGACGGGGCGGG - Intergenic
1132582796 16:693275-693297 AGTGGACCCAGCCAAGGGTCAGG - Exonic
1132692263 16:1186918-1186940 GGTGGACACGGACACAGGGCTGG + Intronic
1132724428 16:1332757-1332779 GGTGGTCCCAGCTACTGGGGAGG + Intergenic
1132796191 16:1724383-1724405 GGTGGCCACAGCCACGTGGCGGG + Intronic
1133210765 16:4262256-4262278 CTTGGACCCAGCCATGGGCCTGG - Intronic
1133440935 16:5820417-5820439 GGTGACCCCGGCCACGTGGCTGG + Intergenic
1133737703 16:8628539-8628561 GGTGGCCCCAGCCTCCTGGCTGG + Intronic
1134534784 16:15017354-15017376 GGCAAACCCAGCCACGGGCCAGG - Exonic
1136136392 16:28259145-28259167 GGGGGTTCCAGCCACGGGGCTGG - Intergenic
1136390599 16:29962000-29962022 TGCGGACCCGGCCGCGGGGCGGG + Intronic
1137666472 16:50252421-50252443 GGTGGAGGCAGCCACTGGGTAGG + Intronic
1139583049 16:67884597-67884619 GGCCAACCCAGCCAAGGGGCCGG + Intergenic
1139861256 16:70023422-70023444 GGCAAACCCAGCCACGGGCCAGG + Intergenic
1139913076 16:70410370-70410392 TGTGGTCCCAGCTACGGGGGAGG - Intronic
1142064055 16:88050276-88050298 TGTGGTCCCAGCCACCGGGGAGG - Intronic
1142204576 16:88776743-88776765 GCTGGACCCTGGCTCGGGGCGGG + Intronic
1144512218 17:15886935-15886957 AGTGGACCCAGCCAGGGGGCAGG + Intergenic
1144749686 17:17639806-17639828 TGTGGTCCCAGCCACTGGGGAGG + Intergenic
1144848593 17:18232818-18232840 GCTGGGGCCAGCCACCGGGCAGG + Intronic
1145123596 17:20282037-20282059 AGTGGACCCAGCCAGGGGGCAGG + Intronic
1145786438 17:27596996-27597018 CGTGGTCCCAGCCAGGGTGCAGG + Intronic
1146295932 17:31650194-31650216 AGTGGAGTCAGCCAGGGGGCTGG - Intergenic
1147115318 17:38294913-38294935 GGTGGCCCCAGCTACTGGGGAGG - Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148414361 17:47494679-47494701 GGTGGCCCCAGCTACTGGGGAGG + Intergenic
1148563204 17:48618080-48618102 GGGCGACCTAGGCACGGGGCAGG - Intronic
1149965127 17:61154555-61154577 TGTGGTCCCAGCCACTGGGGTGG - Intronic
1151370626 17:73644498-73644520 GGAGAACCCAACCAGGGGGCGGG - Intergenic
1151796987 17:76353292-76353314 CGCGGACCCAGTCACGGGGCGGG + Intronic
1151882456 17:76903692-76903714 GGTGGCCCCAGAAATGGGGCAGG - Intronic
1152281967 17:79390115-79390137 TGTGGACCCAGCCCCTCGGCCGG - Intronic
1152772612 17:82179549-82179571 GGTGGACCCAGCCACGGGGTGGG + Intronic
1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG + Intronic
1153522159 18:5963441-5963463 GGTGGAGGCCACCACGGGGCAGG - Intronic
1154490319 18:14917122-14917144 GGAGGACGCAGCCAGGGGGAGGG - Intergenic
1158040772 18:53090570-53090592 TGTGGTCCCAGCCACTCGGCAGG + Intronic
1158137348 18:54222583-54222605 TGTGGTCCCAGTTACGGGGCTGG - Intronic
1158607260 18:58906623-58906645 GGTGAACCCAGCACCGGTGCAGG - Intronic
1159449021 18:68576332-68576354 GGTGGGCCCAGCTACTGAGCAGG + Intergenic
1159940131 18:74400547-74400569 GGTGCACTCAGGCTCGGGGCAGG - Intergenic
1159954100 18:74507391-74507413 GCAGGACCCAGCCACGGAGTGGG - Intronic
1160242071 18:77131876-77131898 GGTGGGCGCAGCGACGGGCCCGG + Intronic
1160539404 18:79612266-79612288 GCTGCACCCAGCACCGGGGCTGG - Intergenic
1160700950 19:507077-507099 GCTGGACCCAGCCCCGCGCCCGG - Intergenic
1160740985 19:685740-685762 GGTGGTCCCAGGCAGGGGGCCGG + Exonic
1161128197 19:2572141-2572163 TGTGGTCCCAGCCACTCGGCAGG - Intronic
1161284013 19:3459623-3459645 TGTGGCCCCAGCAATGGGGCGGG - Intronic
1162299571 19:9836469-9836491 GGAGGTCCCAGCCACAGGCCAGG - Intronic
1162299965 19:9838860-9838882 AGAGGACCCAGCCTGGGGGCTGG + Intronic
1162301514 19:9847607-9847629 GGCTGACCCAGGCAGGGGGCTGG - Intronic
1163437893 19:17306165-17306187 GGTGGCTCCAGCCCCGGGCCTGG + Exonic
1163748117 19:19059978-19060000 GGAGGAGCCGGCCACGGGGAAGG - Intronic
1164245363 19:23423513-23423535 GGTGGTCCCAGCTACTGGGGAGG - Intergenic
1165087993 19:33364628-33364650 TGAGGACCAAGCCAAGGGGCTGG - Intergenic
1165389338 19:35529425-35529447 GGTTGAGGCAGCCACGGGGAGGG + Intergenic
1165832494 19:38736487-38736509 GGTTGACCAAGCCCCAGGGCAGG + Intronic
1165832501 19:38736508-38736530 GGTTGACCAAGCCCCAGGGCCGG + Intronic
1167216836 19:48170689-48170711 GGTGGACGCCGCTCCGGGGCGGG + Exonic
1167667239 19:50829946-50829968 GCAGCACCCAGACACGGGGCTGG + Intronic
1168146735 19:54423775-54423797 GGAGGACGCAGCCACGTGGCAGG - Intronic
1168693758 19:58393516-58393538 GGTGGACACAGCCACGGGAGTGG + Intronic
925185344 2:1842977-1842999 GGTGTTCCCAGCCCGGGGGCCGG - Intronic
925350991 2:3200640-3200662 GGTGGACACAGGGGCGGGGCAGG + Intronic
925611752 2:5707081-5707103 AGGAGACCCAGGCACGGGGCAGG - Intergenic
927090084 2:19704008-19704030 GGTGGAGGCAGACACAGGGCAGG - Intergenic
929688303 2:44053581-44053603 TGTGGACCCAGCTACTGGGGAGG + Intergenic
931694253 2:64859957-64859979 GGCGGCCGCAGCCCCGGGGCGGG + Intergenic
931794162 2:65693452-65693474 AGTGGGCCCAGCCACAGGGAGGG + Intergenic
933811135 2:86033428-86033450 GGTGTAGCCAGCCCCGGGGCAGG - Intronic
934563797 2:95327310-95327332 GGTGGCCTCAGCCACTGAGCTGG - Intronic
934790964 2:97059804-97059826 GCTGGGCACAGCCACGGGGCTGG - Intergenic
934815485 2:97322726-97322748 GCTGGGCACAGCCACGGGGCTGG + Intergenic
934822210 2:97385757-97385779 GCTGGGCACAGCCACGGGGCTGG - Intergenic
936258160 2:110934974-110934996 GGAGGGCCCTGCCAGGGGGCTGG + Intronic
936566111 2:113583942-113583964 GGTGGACCGAGTCGCGGGCCTGG - Intergenic
937234530 2:120422676-120422698 GGTGGACACAGCCTCAGGGTAGG + Intergenic
937998856 2:127715989-127716011 GGTGGAGACAGACACAGGGCAGG + Intronic
939016052 2:136904590-136904612 GATGGCCCCTGCCACAGGGCAGG - Intronic
943184363 2:184587566-184587588 TGTGGACCCAGCTACTGGGGAGG + Intergenic
944154032 2:196592805-196592827 TGGGGACCCGGCCGCGGGGCGGG + Intronic
945088772 2:206159600-206159622 AGTGGCCCCAGCCTCGAGGCCGG + Exonic
945253595 2:207785301-207785323 GGTGGACACAGCCAGCAGGCTGG - Intergenic
946856683 2:223957302-223957324 GGCGGAGACAGCCCCGGGGCGGG - Intergenic
947407467 2:229794443-229794465 TGTGGCCCCAGCTACGTGGCAGG + Intronic
948410686 2:237757799-237757821 GCCCGGCCCAGCCACGGGGCAGG - Intronic
948801802 2:240436461-240436483 GGGAGTCCCAGCCCCGGGGCCGG + Intronic
1168811972 20:710275-710297 GATGGACCGAGCCAAGGGGCGGG - Intergenic
1169214751 20:3786543-3786565 GGTGCCCCCCGCCACGGGCCCGG - Exonic
1169478584 20:5955898-5955920 GGTGCACCCAGCCACTCGGGAGG - Intronic
1170568112 20:17617947-17617969 GGTGGAGCCTGCCAAGGAGCTGG + Intronic
1170570148 20:17628066-17628088 GGGGGACCCAGCCAGGGAGGTGG - Intronic
1171191024 20:23159573-23159595 GGTGGAGCCAGCCTGGGGGTGGG + Intergenic
1171435053 20:25115920-25115942 TGAGGGCCCAGCCCCGGGGCCGG - Intergenic
1173367356 20:42399028-42399050 GGTGGCCCCAGACACTGGGAGGG + Intronic
1174377133 20:50133544-50133566 GGTGGACCCAGGCCAGGGGCAGG + Intronic
1175481816 20:59317037-59317059 GTAGGCCCCAGCCACTGGGCAGG + Intronic
1175800777 20:61800017-61800039 GGTGGGCACAGTCACCGGGCCGG + Intronic
1176042855 20:63074414-63074436 TGTGGACCCAGCCACTTGGGAGG + Intergenic
1176155445 20:63617812-63617834 GGTGGAAGCAGCCTCGGGGTAGG - Intronic
1178532192 21:33385223-33385245 GCTGGGCTCAGCCACGAGGCTGG - Intergenic
1179496123 21:41772372-41772394 GCTGGACCCAGTCAGGGGACAGG - Intergenic
1179785828 21:43729088-43729110 GGAGGCCGCAGCCAGGGGGCAGG - Intronic
1179925760 21:44533397-44533419 GCAGGAGCCATCCACGGGGCAGG - Intronic
1179925804 21:44533517-44533539 GCAGGAGCCATCCACGGGGCAGG - Intronic
1180971428 22:19818131-19818153 GGCAGAGCCAGCCACGGGTCAGG - Intronic
1181616500 22:24058527-24058549 GGTGGGCCCAGTCTCGGGACTGG - Intronic
1182069965 22:27456531-27456553 GGTGGTCCCAGCTACTGGGGAGG + Intergenic
1184288109 22:43483385-43483407 GGTGGAGCACGCCATGGGGCAGG - Intronic
1184298862 22:43543310-43543332 GGGGGACCCAGCCACCAGGGCGG + Intronic
1184442148 22:44523465-44523487 GGTGGTGCCAGCCACGGAGATGG + Intergenic
1184524657 22:45014760-45014782 GGTGGGCCCAGTCACCAGGCGGG + Intergenic
1184529825 22:45048248-45048270 TGTGGTCCCAGCTACTGGGCAGG - Intergenic
1184679424 22:46062088-46062110 GGAGCACCCGGCCCCGGGGCGGG - Intronic
1184890909 22:47378526-47378548 GGTGGACCCAGGGAGGGGGAGGG + Intergenic
1185020772 22:48373642-48373664 TGGGAACCCAGCCACGGGGCTGG + Intergenic
1185258301 22:49848663-49848685 GGTGGATCCGGCGGCGGGGCTGG + Intergenic
1185380390 22:50505132-50505154 GGTGGACCCAGGTGCGGGGCTGG - Exonic
1185409346 22:50674204-50674226 CGGGGGCCGAGCCACGGGGCGGG - Intergenic
949496158 3:4634331-4634353 TGTGGTCCCAGCTACTGGGCAGG - Intronic
950153025 3:10703161-10703183 GGTGGAGCCAGGAAAGGGGCGGG - Intronic
950451513 3:13068138-13068160 ATTGGCCCCAGCCCCGGGGCAGG - Intronic
953030541 3:39177057-39177079 GGTGGTCCCAGCTACTTGGCAGG + Intergenic
954429594 3:50463418-50463440 TGTGGTCCCAGCCACTGGGGAGG - Intronic
956741696 3:72280561-72280583 GGTGGTCCCAGCTACTGGGGAGG - Intergenic
957429587 3:80084886-80084908 GGTGGACACAAACATGGGGCAGG - Intergenic
961324806 3:126103736-126103758 GGGGGCCCCAGCCACGAGGGAGG + Exonic
962095898 3:132292471-132292493 GGTGGACCCAGCTGCTGGGGAGG - Intergenic
968481750 4:836131-836153 GGGGGAGGCAGCCACGGGGGAGG + Intergenic
968579602 4:1383794-1383816 CGTGGAAGCAGCCACAGGGCAGG + Exonic
968910054 4:3473011-3473033 GGAGGCCACAGCCACCGGGCAGG + Intronic
968945643 4:3662160-3662182 GGTGAGCCAAGCCACGTGGCCGG - Intergenic
969248867 4:5954293-5954315 CAGGGACCCAGCCCCGGGGCTGG + Intronic
969492108 4:7505309-7505331 CGGGGAGCCAGGCACGGGGCTGG + Intronic
970096740 4:12472114-12472136 GGTGGGCCCAGGCACAGAGCAGG - Intergenic
972411228 4:38796966-38796988 AGTGGACCCAGACCCGGCGCAGG - Exonic
972414759 4:38827593-38827615 AGTGGACCCAGACTCGGCGCAGG - Exonic
979813112 4:125064637-125064659 GCTGGACCCAGCAATGTGGCTGG + Intergenic
982054413 4:151533272-151533294 TGTGGTCCCAGCTACTGGGCTGG + Intronic
985184483 4:187301234-187301256 AGTGGCCCCACCCATGGGGCAGG - Intergenic
985518569 5:359425-359447 GGTGGACACAGCCACATGCCAGG - Intronic
996065772 5:119077590-119077612 TGTGGTCCCAGCCACGTGGGAGG - Intronic
999168709 5:149574489-149574511 GGTGAACACAACCAAGGGGCAGG - Intronic
1004599189 6:17131221-17131243 GATGGACCCCGCCACAAGGCAGG - Exonic
1004919944 6:20366992-20367014 AGTAGACCCAGCCACTCGGCAGG + Intergenic
1006429781 6:33988543-33988565 GGTGCATCCAGCCTGGGGGCGGG - Intergenic
1006498527 6:34441730-34441752 TGTAGACCCAGCCACTTGGCGGG - Intergenic
1007676814 6:43602787-43602809 TGTGGTCCCAGCTACTGGGCAGG - Intronic
1010691663 6:78918173-78918195 GGTGGTCCCAGCCACTTGGGAGG + Intronic
1016893090 6:149026187-149026209 TGTGGTCCCAGCTACTGGGCAGG + Intronic
1016993892 6:149947535-149947557 GAAGGTCCCAGCCACGGGGAGGG - Intronic
1017004441 6:150020002-150020024 GAAGGTCCCAGCCACGGGGAGGG + Intronic
1017869610 6:158475771-158475793 TGTGGCCACAGACACGGGGCGGG - Intronic
1017897438 6:158692827-158692849 TGTGGTCCCAGCCACTCGGCAGG + Intronic
1018689547 6:166333663-166333685 GGTGGAGTCAGGCACAGGGCAGG + Intronic
1019538935 7:1542945-1542967 GGTGGCCGCAGGGACGGGGCAGG - Exonic
1019562462 7:1665568-1665590 GTTGGAGCCAGCCGCGGGGGCGG - Intergenic
1020173996 7:5867868-5867890 GGTGGTCCCAGCTACCGGGGAGG - Intergenic
1021132896 7:16932990-16933012 TGTGGACCCAGCCACTTGGGAGG - Intergenic
1021219664 7:17961486-17961508 TGTGGTCCCAGCTACGGGGGAGG + Intergenic
1022472991 7:30693097-30693119 GGCAGACCCAGCCAGTGGGCAGG + Intronic
1024521007 7:50304243-50304265 GGGGGACTCGGCGACGGGGCGGG + Intronic
1026797554 7:73376175-73376197 TGTGGTCCCAGCTACGGGGGAGG - Intergenic
1026827630 7:73594224-73594246 GAGGGACCCAGCCTCGGGGGTGG - Intronic
1026969752 7:74460834-74460856 GGGAGACCCCGCCACGGGGGCGG + Intronic
1027193631 7:76012970-76012992 GGTGGACCCATTCAGAGGGCAGG - Intronic
1028922365 7:96322138-96322160 GCTGGGCCCAGCCAATGGGCGGG - Exonic
1033045044 7:137954385-137954407 GGTGGACCCAGGCAGGGGGCAGG + Intronic
1034546983 7:151795431-151795453 GCGGGCCCCAGCCAGGGGGCAGG + Intronic
1036781612 8:11651663-11651685 GGTGTATCCATCCACGTGGCGGG - Intergenic
1037281565 8:17247279-17247301 GGGGGACCCAGCCGCGGAGGAGG - Exonic
1040644448 8:49382094-49382116 GGTGCACCTGGCCACGGGGAGGG - Intergenic
1048864182 8:138747464-138747486 GCTGGACCCAGCAAGGGGCCTGG - Intronic
1050251605 9:3750454-3750476 TGTGGTCCCAGCCACTGGGGAGG - Intergenic
1053008891 9:34622353-34622375 GGGGAACCTTGCCACGGGGCAGG + Exonic
1060601780 9:124882848-124882870 GGTGGACCAAGCCCCCGGGAAGG - Intronic
1060780447 9:126408454-126408476 AGTGGGCCCAGGCAGGGGGCTGG + Intronic
1061003926 9:127917689-127917711 GGTGGTCACAGCCCCGGGTCTGG - Intergenic
1061473273 9:130844241-130844263 GGGGGACCCAGCCAAGGGCGTGG + Intronic
1061538748 9:131266033-131266055 GGTGGACAGAGCCACTGGCCTGG + Intronic
1061853565 9:133429479-133429501 GGTGGGCCCAGGAACGGGGTGGG - Intronic
1062476179 9:136728534-136728556 GGTGGTCCCAGCCATTGGGGCGG + Intergenic
1062507869 9:136887089-136887111 GGTCTCCCCAGCCACTGGGCAGG - Intronic
1185737449 X:2504005-2504027 GTTGCACCCAGCCACTGGGTGGG + Intergenic
1188473613 X:30567152-30567174 GGTGGTCCCAGCTACTTGGCAGG + Intronic
1190127699 X:47721563-47721585 GGTGGAGCCTGGCAAGGGGCGGG + Intergenic
1193599566 X:83493716-83493738 GGGGTACCCAGCCACTGGGCTGG + Intergenic
1199175537 X:144783772-144783794 GGGGGACCCAGCCGCTGGCCCGG - Intergenic
1201416480 Y:13752903-13752925 GGGGGTCCATGCCACGGGGCAGG - Intergenic