ID: 1152773967

View in Genome Browser
Species Human (GRCh38)
Location 17:82188337-82188359
Sequence AGCCCACGTGGAGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152773967_1152773975 22 Left 1152773967 17:82188337-82188359 CCTGCAGCTGCTCCACGTGGGCT 0: 1
1: 1
2: 3
3: 31
4: 288
Right 1152773975 17:82188382-82188404 CATCCTTCTCCCTGGCCAGACGG 0: 1
1: 0
2: 4
3: 33
4: 297
1152773967_1152773974 14 Left 1152773967 17:82188337-82188359 CCTGCAGCTGCTCCACGTGGGCT 0: 1
1: 1
2: 3
3: 31
4: 288
Right 1152773974 17:82188374-82188396 CAGCACTGCATCCTTCTCCCTGG 0: 1
1: 1
2: 1
3: 25
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152773967 Original CRISPR AGCCCACGTGGAGCAGCTGC AGG (reversed) Exonic
900077376 1:828047-828069 AACCCGCGCGGAACAGCTGCCGG - Intergenic
900287949 1:1910744-1910766 AGCCACCGTGGGGCAGCTGGAGG + Intergenic
900345624 1:2209003-2209025 GGCCAGGGTGGAGCAGCTGCTGG - Intronic
900532298 1:3160586-3160608 TGCCCACGAGGTGCAGGTGCAGG + Intronic
900832444 1:4974859-4974881 AGCCCACGAGGCGCAGCTCCAGG - Intergenic
901302716 1:8211250-8211272 AGCCCAGGTGGAGCAGCCTCGGG + Intergenic
901934276 1:12617081-12617103 AGCCCACCTGCTGCCGCTGCGGG - Intronic
902317485 1:15633452-15633474 AGTCCTGGTGGAGCAGCAGCAGG + Exonic
902889975 1:19435805-19435827 AGCACAGGTGGCCCAGCTGCTGG - Intronic
904188920 1:28728259-28728281 AGGCCACCTGGCCCAGCTGCAGG + Intergenic
904842344 1:33380801-33380823 ATCCCACATGGAGCAGCTTGTGG - Intronic
906052712 1:42888031-42888053 AGGCCACGAGCAGCAGCAGCAGG + Intergenic
907730583 1:57061725-57061747 ATCCCATGAGGAGCAGCTGAAGG - Intronic
909076456 1:71054716-71054738 ACCCCACGTGGTGCACATGCCGG + Intergenic
910850247 1:91642849-91642871 AGACCACGTGGATCAGATGTGGG - Intergenic
918245759 1:182657602-182657624 ATCCCAGGTGGAACAGCTTCAGG - Intronic
919880545 1:201897947-201897969 AGCCCACGGGGCAAAGCTGCTGG - Exonic
921168698 1:212526392-212526414 AGTTCACGTGAAGCACCTGCAGG - Intergenic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
1063300196 10:4844021-4844043 ACACCATGTGGAGCAGATGCCGG - Intronic
1067187871 10:44045314-44045336 AGGCCATGTGGATCAGCTGGTGG - Intergenic
1067229272 10:44395523-44395545 AGCCCAGCAGGAGCAGCTGAGGG + Intergenic
1067549700 10:47225772-47225794 GGCTCATGTGAAGCAGCTGCTGG - Intergenic
1067727073 10:48778506-48778528 AGCCCAGGTGCAGCACCTACTGG - Intronic
1068560771 10:58512757-58512779 AGCCCACGGGGAGCCGCGGCGGG - Intergenic
1068938277 10:62657330-62657352 AGCCCATCTGGAGCAGCCGCTGG + Intronic
1069409529 10:68139089-68139111 CTCCAACATGGAGCAGCTGCTGG + Intronic
1069589477 10:69632897-69632919 AGCCCATGTTCACCAGCTGCCGG - Exonic
1070999175 10:80814430-80814452 AGCCCAGGTGGGGGAGCTGGGGG - Intergenic
1071875374 10:89837938-89837960 ACCCCACGGAGAGCAGCTGGGGG - Intergenic
1072717214 10:97760059-97760081 AGCTCCGCTGGAGCAGCTGCAGG + Exonic
1073321970 10:102621039-102621061 AGCCCACTTGGAACAGCTGCTGG - Intronic
1073681679 10:105711725-105711747 AGCTCACTCTGAGCAGCTGCTGG + Intergenic
1073786891 10:106899450-106899472 ACCCCATGTGGATAAGCTGCGGG + Intronic
1073961005 10:108928299-108928321 ACCCTATGTGGAGCAACTGCAGG - Intergenic
1075102779 10:119517934-119517956 TGCCCACTGTGAGCAGCTGCAGG + Intronic
1076062986 10:127427956-127427978 AGCCCAGCGGGAGCTGCTGCAGG + Intronic
1076139466 10:128068116-128068138 AGCCGTCGGGGAGCTGCTGCGGG - Exonic
1076804881 10:132850354-132850376 AGCCCACGCTCAGCGGCTGCAGG + Exonic
1076809418 10:132878901-132878923 AGCCCACCAGGAGCAGCTGTCGG - Intronic
1076821316 10:132941327-132941349 TGCCCACTCGGGGCAGCTGCAGG + Intronic
1076850840 10:133091943-133091965 CGGCCTCGGGGAGCAGCTGCAGG - Intronic
1077542274 11:3152549-3152571 ATCCCATGTGGAACAGCAGCGGG + Intronic
1077877447 11:6320146-6320168 AGCCCAGGTGCAGCGGCTGGAGG - Exonic
1078106582 11:8361687-8361709 AGCCCAAGGTGAGCAGCTGGTGG - Intergenic
1078558941 11:12354086-12354108 AGACCAGGGGGAGCAGCTGAAGG - Intronic
1083255326 11:61491851-61491873 AGCCCACATGGAGCCCCAGCCGG - Intergenic
1083822923 11:65182746-65182768 AGCCCAAGTGCAGAAGCAGCGGG + Exonic
1088250919 11:107860107-107860129 ACCCCAAGTTTAGCAGCTGCAGG + Intronic
1088724274 11:112620583-112620605 ACCCCACTGGGTGCAGCTGCAGG + Intergenic
1088927915 11:114320890-114320912 ACTCCACTTGGAGCAGCTGGGGG - Intergenic
1089152272 11:116373293-116373315 AGGCCACGAGGAGCTGCAGCTGG - Intergenic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1092387070 12:8043987-8044009 AGCCCACGGGGAGGCGTTGCAGG + Exonic
1097235152 12:57534341-57534363 TTCCCACCTGGAGAAGCTGCTGG - Exonic
1101352195 12:103941485-103941507 AGACCACGTGGAGCAGATGTGGG - Exonic
1101438035 12:104680624-104680646 TTCCCACATGGAGCAGGTGCAGG - Intronic
1102027044 12:109719583-109719605 AGCCCTCCAGGACCAGCTGCAGG - Intronic
1104420090 12:128627890-128627912 ACCTCAAGTGGTGCAGCTGCTGG - Intronic
1105972933 13:25447496-25447518 AGCTCACAGGGAGCAGGTGCAGG + Intronic
1106205484 13:27589887-27589909 AGCCCACGTGTTGGAGGTGCTGG - Intronic
1108817748 13:54312994-54313016 GGCCCACATGGTGCAGCGGCGGG - Intergenic
1109142393 13:58730644-58730666 TGGCCCCTTGGAGCAGCTGCTGG + Intergenic
1111268682 13:85853172-85853194 AGCCCTTCTGAAGCAGCTGCTGG + Intergenic
1113403486 13:110017480-110017502 AGCGCACGTGCAGCACCAGCTGG - Intergenic
1113788774 13:113016459-113016481 GGCCCACGTGGAGGGGTTGCCGG - Intronic
1113800726 13:113085163-113085185 AGCCCACCTTGAGCAGCAGCTGG - Exonic
1113858511 13:113464674-113464696 GGCCCACGTGGGGCAGCTGGAGG + Intronic
1114483289 14:23048207-23048229 CGCCGACGTGGCGCAGCTCCTGG - Exonic
1114593327 14:23890166-23890188 AGCTCTTGTGGGGCAGCTGCTGG - Intergenic
1115529382 14:34312955-34312977 AGCCCAGGTGGAGGAGATGGTGG + Intronic
1118316004 14:64726554-64726576 GGCCCACCTGGAGCAGCCGGGGG - Intronic
1118599791 14:67464119-67464141 AGGCCAGGTGGTGCAGGTGCAGG - Intronic
1120148020 14:81000938-81000960 AGCCCACAGGCAGCATCTGCAGG - Intronic
1120341454 14:83225794-83225816 AGCCCATCAGGAGCAGCAGCGGG - Intergenic
1122504458 14:102222739-102222761 TGACCACGTGGAGCTGCTGGCGG + Intronic
1122922710 14:104886566-104886588 GGCCCACGTGGAGCAGGGGTCGG + Exonic
1123056814 14:105574722-105574744 CGCCCATGAGGAGCTGCTGCTGG - Intergenic
1123081396 14:105697063-105697085 CGCCCATGAGGAGCTGCTGCTGG + Intergenic
1124444983 15:29722562-29722584 AGCCCTCATGGAGCACCTCCAGG + Intronic
1124848067 15:33310974-33310996 AGCGCACGCCGAGCGGCTGCCGG + Exonic
1126686110 15:51250322-51250344 AACCCACATGGAGCACCTCCTGG - Intronic
1127393176 15:58522982-58523004 AGCCCAGATGGACCGGCTGCTGG + Intronic
1127972829 15:63975137-63975159 AGCCCCAGTGGAGCACATGCTGG - Intronic
1128303947 15:66585942-66585964 AGCCCACCTGTAGCAGCTCAAGG + Intronic
1131537857 15:93252528-93252550 AGCCAACCTGGAGCTGCTGGAGG + Intergenic
1132013996 15:98300095-98300117 GGCCCAAGTGGAGAAGCTGGTGG - Intergenic
1132372712 15:101309371-101309393 TGCCCACGAGGACCCGCTGCTGG - Intronic
1132607967 16:801355-801377 AGCCCAAGTGCTGCAGCTGGGGG - Intergenic
1132628214 16:902437-902459 AGCCCCCAGGGCGCAGCTGCAGG - Intronic
1132645901 16:999156-999178 ACCCCAGGTGGGGCAGCTCCCGG + Intergenic
1132731995 16:1367226-1367248 GGCACAGGTGAAGCAGCTGCAGG - Intronic
1132734805 16:1379938-1379960 AGTCCGCCCGGAGCAGCTGCAGG - Intronic
1132858986 16:2060798-2060820 ACCCCACCTGGAGCTGCTGAAGG - Exonic
1133964042 16:10518619-10518641 TCAGCACGTGGAGCAGCTGCTGG - Intergenic
1134235590 16:12463018-12463040 AGTCCACGTGAGGCAGCTCCTGG - Intronic
1134844148 16:17425666-17425688 AGCCCAGGTGTAGCAGCAGGTGG - Intronic
1135286151 16:21194966-21194988 AGCTGGTGTGGAGCAGCTGCCGG - Intergenic
1138190668 16:55011057-55011079 GGCACAGCTGGAGCAGCTGCAGG + Intergenic
1139668145 16:68472596-68472618 AGGCCAGCTGGAGCAGCTGAGGG + Intergenic
1140769610 16:78191240-78191262 TGCCCAGGTGGAGGAGCTGTGGG - Intronic
1142243253 16:88956653-88956675 AGGCCAGGTGGGGCAGCTGCAGG - Intronic
1142269514 16:89081873-89081895 GGGCCACAGGGAGCAGCTGCAGG - Intergenic
1142613396 17:1121510-1121532 ATCCCACTGTGAGCAGCTGCAGG - Intronic
1142613766 17:1123654-1123676 ACCCCACTGTGAGCAGCTGCAGG - Intronic
1142668582 17:1476628-1476650 ACCCCTCAAGGAGCAGCTGCAGG + Intronic
1143393463 17:6574288-6574310 AGCCCAGGCGGACCAGCTGGAGG + Intergenic
1143950973 17:10631902-10631924 GGCCGAGGTGGAGGAGCTGCGGG - Exonic
1144065098 17:11617642-11617664 AGCCCCCAGGGAGCAGTTGCTGG - Intronic
1144519099 17:15942612-15942634 AGCCCAGGCCCAGCAGCTGCAGG + Intergenic
1145819044 17:27817263-27817285 CTCCCAGATGGAGCAGCTGCTGG - Intronic
1146122665 17:30209215-30209237 GGCCTACGTGGTGAAGCTGCTGG - Exonic
1149604416 17:57914738-57914760 AGGCCAGGTGGGGCAGGTGCAGG - Intronic
1149978713 17:61292114-61292136 ATGTAACGTGGAGCAGCTGCTGG + Intronic
1150069744 17:62140471-62140493 GGGCCACGTGGAGCTGCTGGAGG - Intergenic
1150292903 17:63992002-63992024 GGCCCCCGAGGAGCAGCTTCAGG - Intergenic
1151390851 17:73785824-73785846 GGGCCACGTGGAGCTGCAGCCGG + Intergenic
1151584718 17:75002091-75002113 GGCTCAGGTGGAGGAGCTGCAGG + Exonic
1151893337 17:76963980-76964002 AGAGCACGTGGACCATCTGCAGG + Intergenic
1152108154 17:78342474-78342496 AGCCCACGGGCCGCAGCCGCAGG + Intergenic
1152557016 17:81058494-81058516 GGCCCACGTGGTGGTGCTGCAGG + Intronic
1152586008 17:81189804-81189826 CGACCACCTGGAGGAGCTGCTGG - Exonic
1152594062 17:81229646-81229668 ATCCCACCGAGAGCAGCTGCTGG + Intronic
1152661254 17:81543291-81543313 AGCCCAGGTGGAGCTGAGGCAGG + Intronic
1152773967 17:82188337-82188359 AGCCCACGTGGAGCAGCTGCAGG - Exonic
1152828145 17:82480347-82480369 AGCCGGCGTGGAGCTGTTGCTGG - Intronic
1203170863 17_GL000205v2_random:147115-147137 AACCCATGTGGAGGAGCTGAGGG - Intergenic
1154147856 18:11880904-11880926 AGGCCACGCTGAGCAGGTGCTGG - Intronic
1154367640 18:13726210-13726232 GGCGCACGCGGAGCAGTTGCCGG + Intronic
1155154568 18:23147852-23147874 AGCCCACGTGGGGCACATGCTGG + Intronic
1155245499 18:23904708-23904730 AGCGAATGTGGAGAAGCTGCTGG - Intronic
1156513692 18:37662126-37662148 AGCCCACGGGGAGCAGAGGATGG - Intergenic
1157667378 18:49499203-49499225 CCCCAACGTGGGGCAGCTGCGGG - Intergenic
1157718627 18:49906552-49906574 GGCCTACCTGGAGAAGCTGCGGG - Exonic
1160196420 18:76759187-76759209 AGCCCATGCGGAGCTGCTGTGGG - Intergenic
1160231271 18:77051463-77051485 AGCCCACCTGGGGCTGCTTCTGG + Intronic
1160729141 19:632834-632856 GGGCCACGTGGAGCTGCTGGAGG - Exonic
1162386212 19:10361940-10361962 GGCCCAAGTGGGACAGCTGCGGG + Exonic
1162728741 19:12705281-12705303 TGGTCACGTGGAGCAGCTGGTGG - Exonic
1162740534 19:12771172-12771194 ATCCCAGCTGGAGCAGTTGCAGG - Exonic
1162943854 19:14030893-14030915 CCCCCACTTGCAGCAGCTGCTGG - Exonic
1163332954 19:16653027-16653049 AGCCCAGGTGGAGCAGGATCTGG + Intronic
1163429643 19:17259597-17259619 AGCCCAGATGGAGCAACTCCGGG - Exonic
1164916035 19:32053059-32053081 AGCCCACGTGGAGCATTTCCAGG + Intergenic
1165153606 19:33774645-33774667 TCCCCAGGTGGAGGAGCTGCTGG + Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166842749 19:45708691-45708713 AGCCCACAGTGAGCAACTGCAGG - Intergenic
1167499155 19:49835838-49835860 GGCCCTCCTGGAGCAGCTTCTGG + Exonic
1167616820 19:50539214-50539236 AGCCAAAGTGGGGCAGCTACAGG - Intronic
1168113559 19:54208545-54208567 AGCCCAGATGGTGCAGCAGCTGG - Intronic
1168300260 19:55401025-55401047 AGGCCACCAGGAGCAGCTCCAGG + Exonic
1168485644 19:56759926-56759948 AGCCCAGGTGCAGCAGGTGCAGG + Intergenic
925592244 2:5521644-5521666 TGCTCACTTAGAGCAGCTGCTGG + Intergenic
928003657 2:27543754-27543776 AGCCCAGGTGCAGCAGCTTAGGG - Intronic
928385840 2:30867178-30867200 ACCCAACGTGGAGTTGCTGCAGG - Intergenic
928388092 2:30886412-30886434 TGCCCACCTGGAGCAGCTGCTGG + Intergenic
929033859 2:37672447-37672469 GGCGCAAGTGGCGCAGCTGCCGG + Intronic
929847286 2:45542534-45542556 AGCCCATCTGGAGCAGCTGCTGG - Intronic
930000145 2:46855938-46855960 AGCCAATGATGAGCAGCTGCTGG + Exonic
931711079 2:64989407-64989429 AGCCTCCCTGGAGCAGCCGCCGG - Exonic
934004385 2:87747897-87747919 AGGCAGCGTGGAGCAGCTGAGGG + Intergenic
934746239 2:96761350-96761372 GGCTCACGTTGACCAGCTGCTGG - Exonic
934989533 2:98911618-98911640 AGCCCACCTGAAGGAGCTGGTGG + Intronic
935732280 2:106074010-106074032 AGCCCATGTAGAGAAACTGCTGG - Exonic
935733040 2:106081179-106081201 AGCACACATGGAACAGATGCTGG - Intergenic
938548120 2:132353252-132353274 CGCCCCCGTGCAGCTGCTGCAGG - Intergenic
942186739 2:173431425-173431447 AGCACAGGTGCAGCAGGTGCAGG + Intergenic
942535882 2:176963282-176963304 ATCCCAGGTGGAGCAGTTGTGGG + Intergenic
944364825 2:198905811-198905833 ATGCCACGAGGAGCAGCTTCAGG - Intergenic
947028776 2:225768983-225769005 AGCCCACACTTAGCAGCTGCTGG + Intergenic
947534705 2:230933435-230933457 AGCCCATGGTGTGCAGCTGCTGG + Intronic
947670196 2:231930856-231930878 AGGCCATCTGGAGCAGGTGCTGG - Intergenic
947806696 2:232973621-232973643 AGACCACGTGGAGCAGAGGCAGG + Intronic
948580788 2:238986207-238986229 AGCCCGCGTGGAGAGGCAGCGGG - Intergenic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
1168790397 20:572265-572287 AGCCCACTCGCTGCAGCTGCGGG - Intergenic
1169309199 20:4521190-4521212 GGCCCACCTGGAGCGGCTGCTGG + Intergenic
1169488431 20:6052493-6052515 CGGCCACCTGGAGCAGCTGCAGG - Exonic
1169503174 20:6181119-6181141 AACTAAAGTGGAGCAGCTGCAGG - Intergenic
1171409192 20:24934711-24934733 ACCCCACGGTGGGCAGCTGCAGG + Intergenic
1171876989 20:30586024-30586046 CGCCCCCGTGCAGCTGCTGCAGG - Intergenic
1172278883 20:33696590-33696612 AGCCCACAAGGAGAAGCTGGAGG + Intergenic
1172507755 20:35476580-35476602 TGCTCACCTGGAGAAGCTGCTGG - Exonic
1172870085 20:38130302-38130324 GGCCCATGTGGAGCGGCAGCAGG + Exonic
1172886152 20:38232162-38232184 TGCCCACGTGGAGTGGCTGGTGG - Intronic
1172997799 20:39083768-39083790 TGCCCGGGAGGAGCAGCTGCTGG + Intergenic
1173250667 20:41362707-41362729 GGCCCACCTGCAGCGGCTGCGGG - Exonic
1174894403 20:54433803-54433825 AGCCGACGTGGAACTGCAGCAGG - Intergenic
1175203003 20:57290852-57290874 GGGCCAGGTGGAGCAGCAGCAGG - Intergenic
1176045935 20:63092567-63092589 GCCCCACGTGGGGCAGCAGCCGG - Intergenic
1176081832 20:63277303-63277325 GCCCCACGAGGAGCAGCTACCGG - Exonic
1176293737 21:5059613-5059635 ACCCCCTGTGGAGCAGCTGTGGG - Intergenic
1176330851 21:5547266-5547288 AACCCATGTGGAGGAGCTGAGGG + Intergenic
1176396906 21:6273685-6273707 AACCCATGTGGAGGAGCTGAGGG - Intergenic
1176440251 21:6715419-6715441 AACCCATGTGGAGGAGCTGAGGG + Intergenic
1176464513 21:7042488-7042510 AACCCATGTGGAGGAGCTGAGGG + Intergenic
1176488074 21:7424267-7424289 AACCCATGTGGAGGAGCTGAGGG + Intergenic
1178514684 21:33236567-33236589 AGCCCTCCTGGTGCAGATGCTGG - Intronic
1179494083 21:41760738-41760760 ACCCCAGGAGGAGCAGCTGGGGG + Intronic
1179863522 21:44204035-44204057 ACCCCCTGTGGAGCAGCTGTGGG + Intergenic
1179900595 21:44391496-44391518 GGGCCACGTGGTGCATCTGCAGG - Exonic
1179979557 21:44889023-44889045 GGCCCAAGTGGGGCAGATGCGGG + Intronic
1180705629 22:17808249-17808271 AGCCGACGTGGAGCAGACTCCGG - Intronic
1183331215 22:37222677-37222699 ACCCCACTTGGAGTGGCTGCTGG + Intergenic
1183481233 22:38066620-38066642 ACCCCACAGGGAGCAGCTGTAGG - Intronic
1183696255 22:39424909-39424931 AGCCCACCAGGACCAGGTGCAGG + Intronic
1184167183 22:42736726-42736748 AGCCCACCTGGAGCATGGGCTGG - Intergenic
1184684397 22:46089606-46089628 GGCCCACCTGGAGGGGCTGCTGG + Intronic
950695906 3:14701095-14701117 AGGCCACCTGGAGCATCTGCTGG - Intronic
953061834 3:39434236-39434258 AGCCCAGGTGGAGCCTCTGGTGG + Intergenic
954304972 3:49720828-49720850 GGCCCAAGTGGAACAGATGCTGG + Exonic
954698119 3:52438181-52438203 AGCCCACGTATAGCATTTGCTGG + Exonic
954745706 3:52786443-52786465 TGCCCACCTGGGGCAGCTGCAGG - Intronic
956103593 3:65793672-65793694 GGCCTGGGTGGAGCAGCTGCAGG + Intronic
958642906 3:96831352-96831374 AGCCCACGTGGAGGAGGATCAGG - Intronic
958758212 3:98275233-98275255 AGCACACCTGGCCCAGCTGCAGG + Intergenic
961052790 3:123761357-123761379 ACCCAACGTGGAGCAGGTGTTGG - Intronic
962937112 3:140091232-140091254 AGACCACACAGAGCAGCTGCGGG + Intronic
969402238 4:6963119-6963141 AGCCCTCCCGGACCAGCTGCCGG - Intronic
971138385 4:23896466-23896488 ATCCTAAGTGGAGCAGCTGTTGG - Intronic
975728331 4:77314183-77314205 AGCCCACTTGGATCAGCTAATGG - Intronic
978746797 4:112203945-112203967 AGCCCTCTTGGGGCATCTGCTGG + Intergenic
978839668 4:113196403-113196425 AGGCCACGTGGGGCTGGTGCAGG + Exonic
979950829 4:126891485-126891507 AGACCACGTAGAGCATCTTCAGG + Intergenic
984852551 4:184167025-184167047 GGCACAGGTGGGGCAGCTGCGGG - Intronic
985493462 5:192216-192238 GGGCCACGTGCAGCAGCTTCTGG + Exonic
985692971 5:1323626-1323648 AGCCCACCGTGTGCAGCTGCAGG + Intronic
985733190 5:1563064-1563086 GGCCCAGCTGGAGCTGCTGCGGG - Intergenic
985798657 5:1985878-1985900 AGTCCACCTGGAGCATCTGCTGG - Intergenic
990496222 5:56350643-56350665 ATCCCACCTGCTGCAGCTGCCGG - Intergenic
993457180 5:88140821-88140843 AGCCCACCTGGAGCAGGTCTTGG + Intergenic
994043408 5:95283942-95283964 CGCCTGCCTGGAGCAGCTGCTGG - Exonic
1001236527 5:170034468-170034490 AGGCCTCCTGGAGAAGCTGCTGG + Exonic
1001997933 5:176176934-176176956 AGCACAGGCTGAGCAGCTGCTGG + Intergenic
1002367276 5:178723320-178723342 AGCCCATGTGGAGAACCTGACGG - Intronic
1002379820 5:178818478-178818500 AGCCCAGGCTGAGCAGGTGCAGG - Intergenic
1002535849 5:179874942-179874964 CGCCAACATGGAGCAGCTGCTGG - Exonic
1003442921 6:6159904-6159926 GGCCCACCTGGAACAGCTCCAGG - Intronic
1004518275 6:16339181-16339203 AGGCCTCCTGGAGCAGTTGCTGG - Intronic
1005694168 6:28335933-28335955 AGCCCCCGTGGAGTAGGTGGAGG - Intronic
1007256047 6:40529443-40529465 AGCCCACATTGACCACCTGCAGG - Intronic
1007341013 6:41191631-41191653 AGCCCAGGTGTAGAAGCTGGGGG + Exonic
1008000576 6:46355906-46355928 AGCCCAAGTGGAGCAGCATGAGG - Intronic
1011192130 6:84740177-84740199 AGGCCAGGTGGAGCAGGTGCAGG - Intronic
1013367360 6:109446194-109446216 GGCCAAGGCGGAGCAGCTGCGGG + Exonic
1015492122 6:133838100-133838122 AGCCCCCGGGGAGCAGGCGCGGG - Intergenic
1018112048 6:160545561-160545583 AGCTCACGTGGAGCAGGAGAGGG + Intronic
1018123991 6:160664447-160664469 AGGCAATGTGGAGCAGCTGAGGG - Intergenic
1018229707 6:161663846-161663868 GGACCACGAGGAGCAGCCGCCGG + Intronic
1018613445 6:165663462-165663484 CGCACAGCTGGAGCAGCTGCAGG - Intronic
1019235884 6:170612302-170612324 AACCCGCGCGGAACAGCTGCCGG + Intergenic
1019577590 7:1744923-1744945 AGCCCAGCTGCAGCACCTGCAGG - Exonic
1020445510 7:8262573-8262595 TGGCCACGTGGAACACCTGCCGG - Intronic
1022736786 7:33083665-33083687 AGCCCAAGTGGAGCCTTTGCAGG + Intergenic
1023864655 7:44233022-44233044 AGGCGGCGTGGAGCAGCTGGGGG + Intronic
1024300444 7:47883524-47883546 AGGCCACATGGGGAAGCTGCAGG - Intronic
1025047073 7:55701086-55701108 ACCCCACGCTGAGCAGCTCCAGG + Intergenic
1032078941 7:128849134-128849156 AGCCCACGTTGAGCACCGCCTGG + Intronic
1032473036 7:132192097-132192119 AGCAGAGGTGGAGCAGATGCAGG + Intronic
1033980796 7:147162962-147162984 AGCACTCCTGGAGAAGCTGCTGG - Intronic
1034383694 7:150720598-150720620 AGCCCAGGTGGAGCAGCTGCTGG + Exonic
1034498010 7:151433530-151433552 AGCCAGCCTGGAGCACCTGCTGG + Intronic
1035314569 7:157990133-157990155 AGCCCAGGTGAAGCTGCAGCTGG + Intronic
1035464200 7:159064293-159064315 AGCCCACGGGGCCCAGGTGCAGG - Intronic
1035515797 8:231835-231857 AACCCGCGCGGAACAGCTGCCGG + Intergenic
1037951038 8:23018958-23018980 AGCCCCCATGGGGCAGCAGCTGG + Intronic
1041384081 8:57280131-57280153 GGCACAGGAGGAGCAGCTGCAGG + Intergenic
1041500432 8:58533675-58533697 ACCCCACATGAAACAGCTGCTGG - Intergenic
1044726654 8:95199965-95199987 TGCACACTTGGAGCAGCTGGAGG + Intergenic
1044927890 8:97224637-97224659 TGCACAGGTGGAGCAGCTGCAGG + Intergenic
1045498605 8:102728589-102728611 GGCAGGCGTGGAGCAGCTGCTGG + Intergenic
1045721184 8:105112610-105112632 AGCCCATCTGCAGCAGCAGCTGG - Intronic
1045742939 8:105383773-105383795 AGACCACTTGGAGCTCCTGCTGG + Intronic
1048259842 8:132936300-132936322 AGCCCGGGAGGAGCAGCTGCTGG - Intronic
1049290250 8:141797933-141797955 AGCCCACCCCGAGCAGCTGATGG + Intergenic
1049355000 8:142183213-142183235 AGCCCACGTCAGGCAGCTCCTGG + Intergenic
1049682974 8:143927913-143927935 GGCCCACGAGGAGCAGCTCAAGG - Exonic
1049752012 8:144289397-144289419 AGGCCACATGGAGCTGCTGGTGG - Intronic
1050264878 9:3879547-3879569 AGCCGAAGTGGAACAGCTGCTGG - Exonic
1052872645 9:33523674-33523696 CGCCCCCGTGCAGCTGCTGCAGG - Intergenic
1053752315 9:41269179-41269201 CGCCCCCGTGCAGCTGCTGCAGG + Intergenic
1053752765 9:41273436-41273458 CGCCCCCGTGCAGCTGCTGCAGG + Intergenic
1054257842 9:62833511-62833533 CGCCCCCGTGCAGCTGCTGCAGG + Intergenic
1054258290 9:62837788-62837810 CGCCCCCGTGCAGCTGCTGCAGG + Intergenic
1054333480 9:63782253-63782275 CGCCCCCGTGCAGCTGCTGCAGG - Intergenic
1054351588 9:64021299-64021321 CGCCCCCGTGCAGCTGCTGCAGG - Intergenic
1054938879 9:70718131-70718153 ACCCCACCTGGAGCAGGTGCTGG + Intronic
1054940570 9:70736124-70736146 ACCCCACCTGGAGCAGGTGCTGG + Intronic
1055816675 9:80213944-80213966 AGCCCAAGTAGAGGTGCTGCAGG + Intergenic
1056566525 9:87777531-87777553 ATTTCACGTGGAGCAGGTGCTGG + Intergenic
1057618957 9:96618891-96618913 AGCCCGCGGGGAGGAGCTGCAGG + Intronic
1057719324 9:97519491-97519513 GGCCCACCTGCAGCAGCTCCTGG - Intronic
1058186195 9:101858288-101858310 AGCTCACGTGTAGGGGCTGCTGG + Intergenic
1058961019 9:109993105-109993127 ACTCCAAGAGGAGCAGCTGCAGG - Intronic
1061204783 9:129156629-129156651 AGGCCCCGTGGAGAGGCTGCAGG - Intergenic
1061815487 9:133192111-133192133 AGCTCAGTGGGAGCAGCTGCCGG + Intergenic
1061843185 9:133372048-133372070 AGGCAATGAGGAGCAGCTGCAGG + Intronic
1062173172 9:135146586-135146608 AGCCCACGTGAGGCAGAGGCTGG - Intergenic
1062390581 9:136332099-136332121 GGCCCACGGGCAGCAGCAGCGGG - Intronic
1062390615 9:136332255-136332277 CACCCACCTGGTGCAGCTGCAGG + Intronic
1202800483 9_KI270719v1_random:170587-170609 CGCCCCCGTGCAGCTGCTGCAGG - Intergenic
1202800929 9_KI270719v1_random:174869-174891 CGCCCCCGTGCAGCTGCTGCAGG - Intergenic
1203431244 Un_GL000195v1:93060-93082 AACCCATGTGGAGGAGCTGAGGG - Intergenic
1185652830 X:1661263-1661285 AGCCAATGGGGAGCAGGTGCAGG - Intergenic
1185652854 X:1661377-1661399 AGCCAATGGGGAGCAGGTGCAGG - Intergenic
1185652877 X:1661490-1661512 AGCCAATGGGGAGCAGGTGCAGG - Intergenic
1185652902 X:1661607-1661629 AGCCAATGGGGAGCAGATGCAGG - Intergenic
1185652926 X:1661732-1661754 AGCCAATGGGGAGCAGGTGCAGG - Intergenic
1189003612 X:36971977-36971999 GGCCCAGGTGGAGGAACTGCAGG + Intergenic
1189046024 X:37591918-37591940 GGCCCAGGTGGAGGAACTGCAGG - Intronic
1190362915 X:49666143-49666165 TGGCCTAGTGGAGCAGCTGCGGG - Intergenic
1193070788 X:77303611-77303633 GTCCCACGTGGTGCTGCTGCTGG + Intergenic
1195536521 X:106014210-106014232 GGCCCACGTGTGGCACCTGCTGG + Intergenic
1200095325 X:153656806-153656828 AGCCTATGGGGAGAAGCTGCTGG - Intergenic
1200095422 X:153657400-153657422 AGCCTATGGGGAGAAGCTGCTGG + Intergenic
1200134904 X:153870137-153870159 CGCCCACTTTCAGCAGCTGCAGG + Exonic
1200292584 X:154886710-154886732 CGCCTACGGGGAGCCGCTGCAGG + Exonic
1200339428 X:155382450-155382472 CGCCTACGGGGAGCCGCTGCAGG + Exonic
1200347042 X:155458243-155458265 CGCCTACGGGGAGCCGCTGCAGG - Exonic
1200951460 Y:8903089-8903111 GGCCGACGTGGAGCAGCAGCAGG - Intergenic
1202161487 Y:21940223-21940245 GGCCGACGTGGAGCAGCAGCAGG + Intergenic
1202229869 Y:22646150-22646172 GGCCGACGTGGAGCAGCAGCAGG - Intergenic
1202313287 Y:23550015-23550037 GGCCGACGTGGAGCAGCAGCAGG + Intergenic
1202557515 Y:26120579-26120601 GGCCGACGTGGAGCAGCAGCAGG - Intergenic