ID: 1152778893

View in Genome Browser
Species Human (GRCh38)
Location 17:82217838-82217860
Sequence GCGGGGCCTGCGGTCCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152778885_1152778893 18 Left 1152778885 17:82217797-82217819 CCAGGAAGTTCCACTGAGTTCTC No data
Right 1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG No data
1152778881_1152778893 22 Left 1152778881 17:82217793-82217815 CCCCCCAGGAAGTTCCACTGAGT No data
Right 1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG No data
1152778880_1152778893 26 Left 1152778880 17:82217789-82217811 CCAACCCCCCAGGAAGTTCCACT No data
Right 1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG No data
1152778882_1152778893 21 Left 1152778882 17:82217794-82217816 CCCCCAGGAAGTTCCACTGAGTT No data
Right 1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG No data
1152778879_1152778893 27 Left 1152778879 17:82217788-82217810 CCCAACCCCCCAGGAAGTTCCAC No data
Right 1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG No data
1152778886_1152778893 8 Left 1152778886 17:82217807-82217829 CCACTGAGTTCTCAGTGCTGAGT No data
Right 1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG No data
1152778883_1152778893 20 Left 1152778883 17:82217795-82217817 CCCCAGGAAGTTCCACTGAGTTC No data
Right 1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG No data
1152778878_1152778893 28 Left 1152778878 17:82217787-82217809 CCCCAACCCCCCAGGAAGTTCCA No data
Right 1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG No data
1152778884_1152778893 19 Left 1152778884 17:82217796-82217818 CCCAGGAAGTTCCACTGAGTTCT No data
Right 1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152778893 Original CRISPR GCGGGGCCTGCGGTCCTGGC CGG Intergenic
No off target data available for this crispr