ID: 1152781884

View in Genome Browser
Species Human (GRCh38)
Location 17:82230404-82230426
Sequence GGGCCCTGCCCAAGGTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1005
Summary {0: 1, 1: 1, 2: 28, 3: 176, 4: 799}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152781884_1152781891 7 Left 1152781884 17:82230404-82230426 CCATGTGACCTTGGGCAGGGCCC 0: 1
1: 1
2: 28
3: 176
4: 799
Right 1152781891 17:82230434-82230456 AGGCCACCCAGAAAGCCATGTGG 0: 1
1: 0
2: 2
3: 23
4: 214
1152781884_1152781895 21 Left 1152781884 17:82230404-82230426 CCATGTGACCTTGGGCAGGGCCC 0: 1
1: 1
2: 28
3: 176
4: 799
Right 1152781895 17:82230448-82230470 GCCATGTGGCCTGCACGATCAGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152781884 Original CRISPR GGGCCCTGCCCAAGGTCACA TGG (reversed) Intronic
900131773 1:1090266-1090288 GGGCCCTCCCCTCGGTGACAAGG - Intronic
900398037 1:2461309-2461331 GGGCCCTGGCCAAGGTCGGTGGG - Intronic
900463081 1:2810624-2810646 AGGCCCTGCACAGGGGCACAGGG - Intergenic
900574375 1:3375744-3375766 GGGCACTGCGCACGGTCAGATGG + Intronic
900702503 1:4057100-4057122 AGGGCCTGCCCAAGGCCTCAGGG + Intergenic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901104145 1:6742256-6742278 ATGACCTGCCCAAGGGCACATGG + Intergenic
901148959 1:7087642-7087664 GTGACTTGCCTAAGGTCACATGG - Intronic
901530753 1:9851063-9851085 GAGCCCTGCTCCAGGTCACCTGG - Intronic
901629573 1:10641592-10641614 GGGACCTGCCCAGGTTCAGAGGG - Intronic
901641946 1:10697070-10697092 GGGCCCTGCCCAAGAGGAAAAGG + Intronic
901801925 1:11713266-11713288 CTGTCTTGCCCAAGGTCACACGG + Intronic
901839700 1:11946154-11946176 GGGACTTGCCCCAGGTCACATGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902377252 1:16035587-16035609 GTGACTTGACCAAGGTCACAAGG - Intergenic
902381085 1:16052567-16052589 AGGACTTGCCCAAGGTCACCCGG - Intronic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902382430 1:16058842-16058864 GTGACTTGACCAAGGTCACAAGG - Intronic
902431034 1:16363323-16363345 GAGACTTGCCCAAGGTCACAAGG + Intronic
902434228 1:16386983-16387005 GGAACTTACCCAAGGTCACAAGG - Intronic
902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG + Intronic
902525758 1:17056235-17056257 GGGGCTTATCCAAGGTCACATGG - Intergenic
902559387 1:17267485-17267507 GGGGCTTGTCCAGGGTCACAGGG + Intronic
902789198 1:18753946-18753968 GGACCCAGCACAAGGTCCCAGGG - Intergenic
902795171 1:18796168-18796190 GTGACTGGCCCAAGGTCACACGG - Intergenic
902871137 1:19314237-19314259 GGGTCCTGTCCAAGGTCAGGGGG + Intronic
903010131 1:20323985-20324007 GTCACCTGCCCAAGGTCACATGG + Intronic
903030401 1:20459793-20459815 ATGCCTTGCCCAAGGTCACATGG - Intergenic
903049436 1:20589724-20589746 ATGACTTGCCCAAGGTCACACGG + Intronic
903143757 1:21356405-21356427 GGGACTTGCCCAAGACCACAGGG - Intergenic
903186457 1:21632053-21632075 GTGACCCGCCCAAGGTCACATGG + Intronic
903239621 1:21974228-21974250 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903243429 1:21999156-21999178 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903247413 1:22025971-22025993 GGGACTTGCCCAAAGCCACAAGG - Intergenic
903284199 1:22266997-22267019 GTGACTTGCCCAAGGCCACAAGG + Intergenic
903301258 1:22380159-22380181 GTCCCTTGCCCAAGGTCACAAGG - Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903348173 1:22701154-22701176 GAGCCCTGGCCAGGGTCTCATGG - Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903424823 1:23245804-23245826 TGACCTTGCTCAAGGTCACACGG - Intergenic
903652930 1:24932235-24932257 GGGCCCTGCGCCAGGTGCCAGGG - Intronic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903739531 1:25550677-25550699 GGGACCTGTGCAAGGTAACATGG - Intronic
903742202 1:25564875-25564897 GTGACTTGCCCAAGGTCTCACGG + Intronic
903892859 1:26581456-26581478 GCAACTTGCCCAAGGTCACATGG - Intergenic
903925913 1:26830321-26830343 GTAATCTGCCCAAGGTCACATGG - Intronic
903954465 1:27015492-27015514 GGGACTTCCCCAAGGTCACGTGG - Intergenic
904046817 1:27614239-27614261 GTGACTTGCCCAAGGCCACATGG + Intronic
904055901 1:27669639-27669661 GTATCCTGCCCAAGGTCACTTGG - Intronic
904083162 1:27884782-27884804 GTGCCTTGTCAAAGGTCACACGG - Intronic
904172292 1:28599776-28599798 GTGACCTGTCCAAGGTCACTAGG - Intronic
904201036 1:28819104-28819126 TGGCCCCATCCAAGGTCACATGG - Intronic
904208401 1:28869952-28869974 ATGACATGCCCAAGGTCACAAGG - Intergenic
904363975 1:29998977-29998999 GGCACCTGCCCCAGGCCACAGGG - Intergenic
904463703 1:30695484-30695506 GGAACTTGCCCGAGGTCACATGG + Intergenic
904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG + Intergenic
904565811 1:31427732-31427754 GAGGCCTAGCCAAGGTCACATGG + Intronic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904767881 1:32864337-32864359 AGCACCTGCCCAAGGTCACAAGG + Intronic
905036013 1:34918746-34918768 GGGCCCTGGCCAGGGTCCTAGGG - Intronic
905259695 1:36708732-36708754 CGGGCTTGCCCAAGGTCATACGG - Intergenic
905345512 1:37308667-37308689 GGGCACTGGCCAAAGTCCCAAGG - Intergenic
905562687 1:38940082-38940104 GGGATTTGCCTAAGGTCACATGG - Intronic
905670909 1:39789267-39789289 GGGCGCTGCCCAGGCTCACGCGG - Intergenic
905690626 1:39940260-39940282 GTGACCTGCCTAAAGTCACATGG + Intergenic
905894264 1:41534933-41534955 GTGACTTGCCCAAGGTCACCTGG - Intronic
905894426 1:41535792-41535814 GTGTCTTGCCCAAAGTCACAAGG + Intronic
906072740 1:43029023-43029045 GCTACCTGCCCCAGGTCACACGG - Intergenic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906683237 1:47745124-47745146 AGGACTTGGCCAAGGTCACATGG + Intergenic
906774025 1:48512485-48512507 GGGACTTGCCCAAGGCCACAGGG + Intergenic
907053579 1:51345320-51345342 AGGCTTTGTCCAAGGTCACAAGG + Intergenic
907262950 1:53235305-53235327 GGAACTTGCCCAAGGTCACATGG + Intronic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
907386679 1:54130034-54130056 GTGCTGTGCCCAAGGTCATATGG - Intergenic
907412074 1:54290028-54290050 GGCACTTGTCCAAGGTCACATGG + Intronic
907775924 1:57514792-57514814 GTTCCTTGCCCAAGGTGACAGGG - Intronic
907785687 1:57610443-57610465 GGGACTTGCCCAATGTCACCTGG + Intronic
907816765 1:57925931-57925953 AGCCCCTGTCCAAGGTCAAAAGG - Intronic
907969646 1:59368442-59368464 GGGCTTAGCCCAAAGTCACAGGG - Intronic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
908483924 1:64571804-64571826 AGGCTCTGGCCCAGGTCACAAGG + Intronic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
911143740 1:94532879-94532901 GGGCCCTGCCCAGAGTCACAGGG + Intronic
912391434 1:109305979-109306001 GTGACTTGTCCAAGGTCACAGGG + Intronic
912420526 1:109539534-109539556 GCAACTTGCCCAAGGTCACACGG + Intergenic
912433022 1:109639569-109639591 GGGCTCTGCTCAAGTGCACATGG - Intergenic
912693554 1:111822976-111822998 AGCCCCTGCCCAAGGTCACACGG + Intronic
912853322 1:113145754-113145776 AGGACTTGCCCAAGGCCACATGG + Intergenic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
913195409 1:116452382-116452404 GGACCCTTCCCAAGGTCCCCTGG - Intergenic
913681450 1:121189594-121189616 GAGGCTTGTCCAAGGTCACACGG + Intronic
914033281 1:143977231-143977253 GAGGCTTGTCCAAGGTCACACGG + Intergenic
914156165 1:145090736-145090758 GAGGCTTGTCCAAGGTCACACGG - Intronic
914433438 1:147640214-147640236 AGGAGTTGCCCAAGGTCACAGGG + Intronic
915069261 1:153252588-153252610 AGACCTTGCCCAAGCTCACAAGG + Intergenic
915538351 1:156551437-156551459 GGGATTTGCTCAAGGTCACATGG + Intronic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
916592026 1:166201096-166201118 GTGGCTTGCCCAAGTTCACATGG - Intergenic
916886865 1:169078039-169078061 GGTGTCTGCCCAAGGACACATGG - Intergenic
917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG + Exonic
917191660 1:172424912-172424934 GGGCCCAGCACAAGGCCACAGGG + Intronic
917630726 1:176888838-176888860 GTAACTTGCCCAAGGTCACATGG - Intronic
917651850 1:177085568-177085590 GGAACCTGCCCAGGGTCATATGG - Intronic
919539463 1:198829818-198829840 GGCACCTGGCCAAGGTCACTGGG - Intergenic
919777672 1:201204944-201204966 GTGACCTGTCCAAGGTAACATGG + Intronic
919818179 1:201455233-201455255 GGGAGTTGTCCAAGGTCACAGGG + Intergenic
919854804 1:201697974-201697996 ATACCTTGCCCAAGGTCACAGGG + Intronic
919855992 1:201706504-201706526 GGGGCCTGCCCAGTGTCACCAGG - Intronic
919910521 1:202107878-202107900 ACACACTGCCCAAGGTCACAGGG - Intergenic
919954205 1:202396302-202396324 GTAACATGCCCAAGGTCACATGG - Intronic
920050950 1:203164799-203164821 AGGATCTGCCCAAGGCCACATGG - Intronic
920468764 1:206208112-206208134 GAGGCTTGTCCAAGGTCACACGG + Intronic
920689208 1:208132897-208132919 GCAACTTGCCCAAGGTCACATGG + Intronic
921167976 1:212520826-212520848 ATGACTTGCCCAAGGTCACAAGG + Intergenic
922062116 1:222102923-222102945 CTGCCCTGTCCAAGGTCACCTGG + Intergenic
923202584 1:231726414-231726436 GAGTGCTGCCCAAGGTCACCTGG + Intronic
924175981 1:241391449-241391471 CCACCCAGCCCAAGGTCACACGG + Intergenic
924446666 1:244139074-244139096 GGGCCCTGCTGGAAGTCACAGGG + Intergenic
1063611843 10:7569455-7569477 GGCATGTGCCCAAGGTCACACGG + Intronic
1063735069 10:8743763-8743785 GAAACTTGCCCAAGGTCACATGG - Intergenic
1063973411 10:11397081-11397103 ACCCCCTGCCCAAAGTCACACGG + Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1067296598 10:44978356-44978378 TGGCCTTGCCAAAGGTCCCATGG - Intronic
1067370459 10:45677571-45677593 GTAACCTCCCCAAGGTCACATGG - Intergenic
1069488566 10:68842072-68842094 CTGCTCTGCCCCAGGTCACATGG - Intronic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1069872577 10:71542271-71542293 GTAACTTGCCCAAGGTCACATGG - Intronic
1070758552 10:79008849-79008871 GTAACGTGCCCAAGGTCACAGGG + Intergenic
1070778453 10:79123860-79123882 GGGCCCAGCCCGTGGCCACACGG + Intronic
1070779768 10:79130681-79130703 AGTGACTGCCCAAGGTCACACGG - Intronic
1070960911 10:80499634-80499656 GTCCTTTGCCCAAGGTCACACGG - Intronic
1071481476 10:86068169-86068191 GTGACTTGGCCAAGGTCACATGG + Intronic
1071980275 10:90998456-90998478 CGGCCTGGCCCAAGGTTACAGGG + Intergenic
1072189243 10:93066855-93066877 GGGAACTGCCCAAGGTCATACGG - Intronic
1072552075 10:96486828-96486850 AGCCCCTTCCCAAAGTCACAGGG + Intronic
1072693346 10:97585637-97585659 GGTCACTGCCCAAGGTCATTCGG + Intronic
1072741860 10:97914616-97914638 GGGGCATGCCCAAGGTCACTGGG + Intronic
1073294596 10:102431493-102431515 GTAACTTGCCCAAGGTCACAAGG + Intronic
1073503085 10:103959871-103959893 GTGACTTGCCCAATGTCACAGGG + Intergenic
1073719843 10:106155708-106155730 GAGCACTGGCCAAGGACACACGG + Intergenic
1074082424 10:110178282-110178304 GTGACCTGTTCAAGGTCACATGG + Intergenic
1074491620 10:113944190-113944212 GAGCCCTGAGAAAGGTCACATGG + Intergenic
1074822012 10:117186699-117186721 GTAACTTGCCCAAGGTCACATGG - Intergenic
1075048562 10:119165445-119165467 GTGGCCTGGCCAAGGTCACCCGG + Intronic
1075050266 10:119178444-119178466 GGCGCTTGCCCAAGATCACAGGG + Intronic
1075116184 10:119628902-119628924 GGAACTTACCCAAGGTCACACGG - Intergenic
1075211407 10:120494360-120494382 GCACCTTGCCCAAGGTCACGTGG + Intronic
1075558960 10:123454634-123454656 GGGTCAAGTCCAAGGTCACATGG + Intergenic
1075737995 10:124675819-124675841 GGGCCTTGCCCAAAGTCACATGG - Intronic
1075837412 10:125466564-125466586 GGAATCTGCTCAAGGTCACATGG + Intergenic
1076398602 10:130161275-130161297 GTGACTTGCCCAAGGTCACCTGG + Intronic
1076519693 10:131073797-131073819 GGGGCCTGCCCGAGGACACAGGG - Intergenic
1076934458 10:133558271-133558293 GGGGCTTGCTCACGGTCACATGG + Intronic
1077036102 11:495201-495223 GGAACCTGCCCAGGGCCACAGGG - Intronic
1077146893 11:1050475-1050497 GCAGCCTGCCCAAGGTCACCGGG + Intergenic
1077214735 11:1390582-1390604 GGGCGCGGCCCAAGGACACGCGG + Intronic
1077261747 11:1625595-1625617 GACCCCTGCCCTAGGTCACCGGG - Intergenic
1077282292 11:1751186-1751208 AGGGCCTGCCCAGGGTCACTGGG + Intronic
1077374793 11:2200426-2200448 GGGGCCTCCCCAGGCTCACATGG + Intergenic
1077423267 11:2462841-2462863 GGGCCCAGCCCAGAGTGACAGGG + Intronic
1077486877 11:2842934-2842956 GTGACTTGCCCAAGGTCACCCGG + Intronic
1077532808 11:3105154-3105176 GTGACTTGTCCAAGGTCACACGG + Intronic
1077856330 11:6129823-6129845 GAAACTTGCCCAAGGTCACAGGG + Intergenic
1077911708 11:6577858-6577880 GTAAACTGCCCAAGGTCACACGG + Intronic
1078151029 11:8759806-8759828 GGGCCCTGGCCAAGGACATGAGG + Intronic
1078157656 11:8812667-8812689 GGGACTTGCCCAATGGCACATGG - Intronic
1078256768 11:9664680-9664702 GGGACTTGCCCAAGGTCGCTGGG + Intronic
1078620432 11:12902324-12902346 TGTCCCTGCCAAAGGGCACAAGG + Intronic
1078753699 11:14188734-14188756 AGGACTTTCCCAAGGTCACATGG - Intronic
1078774496 11:14381669-14381691 GTGACCTGCTCATGGTCACATGG - Intergenic
1078899055 11:15624353-15624375 AGTACTTGCCCAAGGTCACATGG - Intergenic
1078927248 11:15885968-15885990 GTGGCGTGCCCAAGGCCACAGGG + Intergenic
1079129490 11:17738961-17738983 GGGACCTGCCCAAGGGCACTCGG + Intronic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1080239574 11:30111011-30111033 GTTGCCTGCCCAAGGTCACGTGG - Intergenic
1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG + Intronic
1080691120 11:34558878-34558900 GCGCCTTGCCTGAGGTCACATGG - Intergenic
1080697959 11:34619546-34619568 GGGCCCTTGGCAAGTTCACAGGG + Intergenic
1080821971 11:35816030-35816052 GGGACCTGGCCTAGTTCACAAGG + Exonic
1080888421 11:36387706-36387728 GTGACTTGCCCAAGGCCACAGGG + Intronic
1081607155 11:44534560-44534582 GTTACTTGCCCAAGGTCACATGG - Intergenic
1081742727 11:45452203-45452225 GAGGCTTTCCCAAGGTCACAGGG + Intergenic
1081781486 11:45716174-45716196 GGGCCGGGTGCAAGGTCACAGGG - Intergenic
1081870497 11:46380840-46380862 GGGGCTTGCTCAAGGCCACAGGG - Exonic
1081997593 11:47375317-47375339 GAGACTTGCACAAGGTCACACGG - Intronic
1082200175 11:49357373-49357395 ATGCCCTACCCAAAGTCACATGG + Intergenic
1082791036 11:57346982-57347004 GTGACTTGGCCAAGGTCACAGGG - Intronic
1082802764 11:57426784-57426806 GGAACTTGCCCAAGGTCACAGGG + Intronic
1083302901 11:61748097-61748119 AAGACCTGCCCAAGGTCGCATGG + Intergenic
1083488730 11:62999573-62999595 GCACCTTGACCAAGGTCACAGGG + Intronic
1083609383 11:63997929-63997951 GGGACTTGCCCAGGGTCCCAGGG + Exonic
1083613381 11:64014940-64014962 CAGAGCTGCCCAAGGTCACAGGG + Intronic
1083622016 11:64053829-64053851 GGGGAGTGCTCAAGGTCACATGG + Intronic
1083655173 11:64226041-64226063 CAGACTTGCCCAAGGTCACACGG + Exonic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1084029780 11:66474466-66474488 AGGGGCTGTCCAAGGTCACATGG + Intronic
1084507312 11:69576279-69576301 AGGCTCTGCCCAAAGTCACCGGG - Intergenic
1084773523 11:71359746-71359768 GGGGCCTCCTCAAAGTCACATGG - Intergenic
1084974688 11:72790267-72790289 GGGCTCTGCCCACAGCCACATGG - Intronic
1085121119 11:73968283-73968305 GGAACTTGGCCAAGGTCACACGG + Intronic
1085170763 11:74448119-74448141 GTGGGTTGCCCAAGGTCACATGG - Intergenic
1085304315 11:75476590-75476612 AGGGCCTGCCCAAGGCCACAGGG - Intronic
1085312339 11:75524142-75524164 GGGACCTGCTCAAGGTCTCAAGG - Intronic
1085323812 11:75591594-75591616 GGGCCATGCCCAAGGACAGCTGG - Intronic
1085380567 11:76113724-76113746 GCATCCTGCCCAAAGTCACAGGG - Intronic
1085385123 11:76153163-76153185 GGGCCTTGCCCTGGGGCACAGGG - Intergenic
1085393960 11:76196904-76196926 GTGATGTGCCCAAGGTCACATGG - Intronic
1085408160 11:76276324-76276346 GTGCCTTGCCTAAGGTCACATGG + Intergenic
1085550047 11:77360756-77360778 GACCCTTGCCCAAGGACACAGGG - Intronic
1085770107 11:79317625-79317647 GTGACCTGCTCAAGGTCATATGG + Intronic
1086262478 11:84957160-84957182 AGTACCTGCCCAAGATCACATGG + Intronic
1086655497 11:89348823-89348845 ATGCCCTACCCAAAGTCACATGG - Intronic
1086931150 11:92694640-92694662 GCTCCTTGCCCAGGGTCACATGG - Intronic
1087251166 11:95902130-95902152 ACACCCTGCCCATGGTCACATGG - Intronic
1087662235 11:101001117-101001139 GTAACTTGCCCAAGGTCACATGG - Intergenic
1088183992 11:107143130-107143152 GGGCTCTGCCTAAGGTTCCAGGG + Intergenic
1088455258 11:110026746-110026768 GAAACTTGCCCAAGGTCACAAGG - Intergenic
1088505227 11:110520975-110520997 AGGACCTGCCCAAGGTCACACGG + Intergenic
1089159287 11:116425063-116425085 GTGAATTGCCCAAGGTCACAGGG + Intergenic
1089607840 11:119651947-119651969 GGGCCTTGCTCAAGGTCACCTGG + Intronic
1089633025 11:119795122-119795144 GGGCCCTTTCCAGGGTCCCATGG - Intergenic
1089685871 11:120146567-120146589 GTAACCTGCCCAAGGTCACAAGG + Intronic
1089705408 11:120274219-120274241 AGAACTTGCCCAAGGTCACATGG - Intronic
1090228830 11:125087442-125087464 GTGCTATGCCCAAGGTCTCATGG - Intronic
1090253396 11:125266271-125266293 GTCACTTGCCCAAGGTCACACGG + Intronic
1090269910 11:125378671-125378693 CAGTCCTGGCCAAGGTCACAAGG + Intronic
1090422033 11:126582015-126582037 GCAGCCTGCCCAGGGTCACACGG + Intronic
1090928529 11:131274415-131274437 GTGCCCTCCCCAAGGCCAGATGG - Intergenic
1091004588 11:131941427-131941449 GTAACTTGCCCAAGGTCACATGG - Intronic
1091218851 11:133919137-133919159 GTGTCCTGCACATGGTCACAAGG + Intronic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092225636 12:6746516-6746538 GTGACCTGCCCAAGACCACAAGG + Intergenic
1092262834 12:6961705-6961727 GTCACTTGCCCAAGGTCACAGGG + Intergenic
1094299647 12:28948424-28948446 GTGATTTGCCCAAGGTCACATGG + Intergenic
1094838480 12:34333222-34333244 GGGTCCAGCCCAAGGTGGCAGGG + Intergenic
1094843776 12:34352672-34352694 GGGTCCAGCCCAAGGTGGCAGGG - Intergenic
1094844664 12:34356191-34356213 GGGGCCAGCCCAAGGTGGCAGGG - Intergenic
1095824894 12:46520708-46520730 GTGGCCTGTCCAATGTCACACGG + Intergenic
1096108490 12:49013656-49013678 GCAACTTGCCCAAGGTCACATGG + Intronic
1096524277 12:52201263-52201285 GACCCCTGCCCAAGTCCACACGG + Intergenic
1096577073 12:52559358-52559380 GAGACCTGCCCACAGTCACACGG - Intergenic
1097184406 12:57188928-57188950 GGGCCCTCCCCCTGGCCACAAGG + Intronic
1097339320 12:58419309-58419331 GGGCCCTTTCCATTGTCACATGG - Intergenic
1097356826 12:58611631-58611653 GGAACTTGCTCAAGGTCACACGG + Intronic
1098954099 12:76670653-76670675 GGAACTTGCCCAAGATCACAGGG - Intergenic
1100507805 12:95237201-95237223 GGAACTTGCCCAAGGTCACAAGG - Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1101437175 12:104673762-104673784 GGAACTTGCCCAAGGTCACACGG - Intronic
1101604241 12:106235751-106235773 GTGACTTGCCCAAGGCCACATGG + Intergenic
1101613188 12:106310638-106310660 GTGACCTTCCCAAGGTCTCATGG + Intronic
1101714470 12:107298408-107298430 GGAGCTTGCCCAAGGACACATGG - Intergenic
1101836069 12:108296222-108296244 CTGACTTGCCCAAGGTCACAGGG - Intronic
1101854421 12:108430193-108430215 ATGACTTGCCCAAGGTCACACGG - Intergenic
1102007754 12:109599283-109599305 CTGTCTTGCCCAAGGTCACATGG - Intergenic
1102024072 12:109703568-109703590 GGGACCTGCCCAAGGTCACGTGG + Intergenic
1102068788 12:110000247-110000269 ATGCCTTGCCCAAGGTCACAGGG - Intronic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102396484 12:112590383-112590405 AGGACCTGCTCAAGGTCACTGGG - Intronic
1102576082 12:113856920-113856942 GTCACTTGCCCAAGGTCACACGG + Intronic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102716341 12:114976247-114976269 GGGGCTTGCTCAGGGTCACATGG + Intergenic
1103063474 12:117877668-117877690 GGAACTTGCCTAAGGTCACATGG + Intronic
1103165115 12:118763712-118763734 GAGACTTGCCCAGGGTCACATGG + Intergenic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103191510 12:119005907-119005929 GAGCTTTGCCCAAGGTCACACGG - Intronic
1103340230 12:120217011-120217033 GGGTCCTGCTCAAGGTGGCAGGG + Intronic
1103343125 12:120231715-120231737 GGCTTGTGCCCAAGGTCACAGGG + Intronic
1103367125 12:120391372-120391394 GTGACTTGCCCAAGGCCACACGG - Intergenic
1103893079 12:124254397-124254419 AGGACCTGCCCCAGGCCACATGG - Intronic
1103917517 12:124383776-124383798 ATTCACTGCCCAAGGTCACAGGG + Intronic
1103972066 12:124678688-124678710 GGGGACCGCCCAAGGGCACAAGG + Intergenic
1104360921 12:128132509-128132531 GTGGCCTGTCCAAGATCACACGG + Intergenic
1104479030 12:129091359-129091381 GGACCCTTCCTAAGCTCACATGG + Intronic
1104560564 12:129840270-129840292 GGGCAGTGCCCAAGGTCACTGGG - Intronic
1104605254 12:130183415-130183437 CATCCTTGCCCAAGGTCACACGG - Intergenic
1104720699 12:131043668-131043690 GGGCCCTGCGCACGCACACAGGG + Intronic
1104728765 12:131093808-131093830 GGCACCTGCCCAAGGCCACCTGG - Intronic
1104978870 12:132564021-132564043 GGGCCGCGCTCACGGTCACACGG + Intronic
1105504647 13:20999073-20999095 TGCGCCTGCCCAAGGTCACCGGG - Intronic
1106247012 13:27959166-27959188 GGGGCCTTCCCAAGGTCAGTAGG + Intergenic
1106374522 13:29172187-29172209 GAGACCTGTCCAATGTCACATGG - Intronic
1106691132 13:32117922-32117944 GGGAGCTGCCCAAAGTCACATGG - Intronic
1107496751 13:40933766-40933788 GGGCCCTGCCCAGGTTCAGCAGG - Exonic
1107794343 13:44034570-44034592 GGGCCCTAACTCAGGTCACAGGG - Intergenic
1108021923 13:46136366-46136388 GGACCCTGTCCGAGGGCACACGG - Intronic
1108065463 13:46572943-46572965 GGAACTTGCCCAAGGTCACTGGG - Intronic
1109697531 13:65979424-65979446 GTGTCTTGCCCAAGGTTACACGG - Intergenic
1110331934 13:74282811-74282833 GTGCCTTGCCCTAAGTCACACGG - Intergenic
1111364482 13:87223805-87223827 GGTTCCTGCCCAAGCTCACAGGG - Intergenic
1112183744 13:97109401-97109423 GGGCCCTGCCAAAGGCTACCTGG - Intergenic
1112485087 13:99812496-99812518 AAGTCCTGCCCAAGGCCACAGGG - Intronic
1113355585 13:109576841-109576863 AGGACTTGCCCAAGGTCTCAAGG - Intergenic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1113731015 13:112641596-112641618 GGGCTGTGCCCAGGGTCACGAGG - Intergenic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1115861219 14:37688034-37688056 TGGACCTGCCCTAGGTCAGAGGG + Intronic
1116057305 14:39879665-39879687 AAGACTTGCCCAAGGTCACAGGG + Intergenic
1116870352 14:50064055-50064077 GGTCCCTGCACAAGGCCACAGGG + Intergenic
1117061773 14:51971193-51971215 AGGACTTGCCCAAGGTCGCATGG - Intronic
1117339132 14:54778902-54778924 GGCCCCTGCTTAAGGGCACAGGG + Intronic
1118387422 14:65267777-65267799 AGGGCCTGCTCAAGGGCACATGG + Intergenic
1118398791 14:65360654-65360676 AGGCTTTGCCCCAGGTCACATGG - Intergenic
1118972244 14:70646642-70646664 GGGGCTTATCCAAGGTCACAAGG - Intronic
1119153281 14:72385635-72385657 CTGCCCTGCCCAGGGACACAAGG + Intronic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119432402 14:74577010-74577032 GTGGCTTGCCCAAGGTCACAAGG + Intronic
1119481800 14:74962652-74962674 AAGACTTGCCCAAGGTCACACGG - Intergenic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120108629 14:80526278-80526300 GAGAGCTGCCCAAGGTCAAATGG + Intronic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121009854 14:90513471-90513493 GTCCCTGGCCCAAGGTCACAGGG - Intergenic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121323613 14:93007138-93007160 GCTGCCTGCCCAAGGTCACACGG + Intronic
1121346924 14:93143116-93143138 GGAACCTGCCCGAGGTCACAGGG - Intergenic
1121429245 14:93875060-93875082 GTGACCTCCCCAAGGTCACATGG - Intergenic
1121442646 14:93958487-93958509 GGGGCTTGTCCAAAGTCACAGGG - Intronic
1121564020 14:94895231-94895253 GTGCCTCACCCAAGGTCACAGGG - Intergenic
1121693039 14:95891537-95891559 GGAGCCTGCCCAGGGCCACACGG + Intergenic
1121748062 14:96318368-96318390 GTGACCTTCCCAAAGTCACATGG + Intronic
1121861698 14:97324754-97324776 AGGACCTGCTAAAGGTCACATGG - Intergenic
1122089981 14:99331479-99331501 GTGACATGTCCAAGGTCACATGG - Intergenic
1122131859 14:99608836-99608858 GTCACTTGCCCAAGGTCACATGG + Intergenic
1122145254 14:99684840-99684862 GTCACCTGCCCAAGGTCACACGG + Intronic
1122193417 14:100066372-100066394 GGGGTTTGTCCAAGGTCACATGG + Intronic
1122422979 14:101589109-101589131 AGACCTTGCCCAAGGCCACAGGG + Intergenic
1122551190 14:102550907-102550929 TGGCACTCCCCAAGGGCACAGGG + Intergenic
1124371508 15:29107075-29107097 GGCCCTTGCCCAGGGCCACATGG - Intronic
1124478892 15:30060471-30060493 GGTCCCACCCCGAGGTCACAGGG + Intergenic
1124827879 15:33116818-33116840 AGGACCTGCCCAAAGTCAGATGG - Intronic
1125732396 15:41900554-41900576 GTGCCTTGCCCAAGGTCATTCGG + Exonic
1126420474 15:48467048-48467070 GGAACTTGCCCAAGGTTACATGG + Intronic
1126699680 15:51356661-51356683 GTGACCTGCCGAAGGTCACACGG - Intronic
1127579866 15:60328309-60328331 GGGACCTGCCCAGGGTCTCCTGG + Intergenic
1127812524 15:62576956-62576978 GTGTCCTGCCCATGGTCACCTGG + Intronic
1127960803 15:63888891-63888913 GAGACCTGCCCAAGGTTACATGG + Intergenic
1128064125 15:64753960-64753982 GTGACTTGTCCAAGGTCACATGG + Intronic
1128084839 15:64878699-64878721 GGGACTTGCCCAAGGCCACCTGG + Intronic
1128232610 15:66046163-66046185 GGGACCTGCTCCAGTTCACATGG + Intronic
1128240623 15:66098791-66098813 CTGCCATGCCCAAGGTCACACGG + Intronic
1128260227 15:66228030-66228052 GTGACCTGCCCATAGTCACAAGG - Intronic
1128554105 15:68618723-68618745 GTAACTTGCCCAAGGTCACATGG + Intronic
1128709464 15:69860920-69860942 GAGACTTGTCCAAGGTCACATGG + Intergenic
1128770605 15:70278861-70278883 GGGACTCGCCCATGGTCACATGG + Intergenic
1129165178 15:73773122-73773144 AGGGCTTGCCCAAGGTCACACGG + Intergenic
1129237351 15:74231669-74231691 TGGACTTGCCCAAGGTCACACGG - Intergenic
1129257679 15:74343376-74343398 GTCACTTGCCCAAGGTCACATGG + Intronic
1129263645 15:74382612-74382634 AGGCCCATCCCAAGGTCCCAGGG + Intergenic
1129521873 15:76191395-76191417 GGGACTTGCTCAAGGCCACAGGG + Intronic
1130152701 15:81323755-81323777 GTGACTTGCCCAAGGTCACCTGG - Intronic
1130323180 15:82856941-82856963 ACTCCTTGCCCAAGGTCACATGG - Intronic
1130347935 15:83066641-83066663 GAGCCCAGCCCAAGGTCATCCGG + Intronic
1130562888 15:84972355-84972377 GTGACTTGCCCATGGTCACAGGG - Intergenic
1130872324 15:87981225-87981247 GTGTCTTACCCAAGGTCACATGG - Intronic
1131117797 15:89805292-89805314 GGGCCCTGCCTGCGGCCACAGGG - Intronic
1131174851 15:90202989-90203011 GTAGCCTGCTCAAGGTCACATGG - Intronic
1132248621 15:100316872-100316894 AGGCCCTGCCCAAGGCCACTAGG + Intronic
1132391808 15:101444645-101444667 TGTCCTTGTCCAAGGTCACATGG - Intronic
1132433609 15:101779395-101779417 GGGCCCTCCCCATGGACACCTGG + Intergenic
1132578466 16:674646-674668 GTGGCCTTCCCAAGGTCACCCGG + Intronic
1132609644 16:808931-808953 GGGCCCTGTCCAAGGGCAGGAGG + Intronic
1132699742 16:1217333-1217355 ACGCCATGCCCAACGTCACATGG + Intronic
1132727036 16:1343365-1343387 GGGCCCGGCCCATGGTCAAAGGG - Intronic
1132828650 16:1917192-1917214 GGACCCTGCCCAAGGCCAGTTGG - Intronic
1133326344 16:4944609-4944631 GCCACCTGCCCAAGGTCACACGG - Intronic
1133384026 16:5354408-5354430 GTGACTTGCCTAAGGTCACATGG - Intergenic
1133487172 16:6231538-6231560 GTGCCCTTGCCAAGGACACATGG - Intronic
1133621549 16:7531489-7531511 GGATGTTGCCCAAGGTCACAAGG + Intronic
1133679851 16:8110700-8110722 ATGCCTTGCCCAAGGTCATATGG + Intergenic
1133690433 16:8209306-8209328 AGGATCTGTCCAAGGTCACATGG - Intergenic
1133730856 16:8577441-8577463 GGGACTTACCTAAGGTCACATGG - Intronic
1133763001 16:8814623-8814645 GGGATTTGCCGAAGGTCACACGG + Intronic
1133783370 16:8956381-8956403 GGGCTCTTTCCAAGGACACACGG + Intronic
1134214359 16:12305362-12305384 AATCCCTGCCCAAGGTGACAGGG + Intronic
1134248768 16:12559609-12559631 GGGCCATGTGCAAGGTCACGTGG - Intronic
1134372991 16:13643024-13643046 GTGAACTGCTCAAGGTCACATGG - Intergenic
1134567921 16:15266847-15266869 ACGCCCTACCCAAGGTCGCATGG - Intergenic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134734514 16:16489506-16489528 ACGCCCTACCCAAGGTCGCATGG + Intergenic
1134932952 16:18222400-18222422 ACGCCCTACCCAAGGTCGCATGG - Intergenic
1135660323 16:24291041-24291063 GTGACATGCCCAAGGTCACCTGG - Intronic
1135851269 16:25966181-25966203 GGGACATGGCCAAGGTCATATGG + Intronic
1136016012 16:27401777-27401799 GAACCTTGCCCAAGGTCCCACGG - Intergenic
1136111122 16:28063997-28064019 AGGCCCTGCCCCAGGAGACAAGG + Intergenic
1136179317 16:28539896-28539918 GGGACTCGCCCAAGGTCACACGG - Intergenic
1136448334 16:30337552-30337574 GGGCCTCGTCCAAGGTCACAAGG - Intergenic
1136470553 16:30477025-30477047 GAGACTTGACCAAGGTCACATGG + Intronic
1136500291 16:30666717-30666739 CTGCCTTGCCCAAGGTCCCATGG - Intronic
1137557731 16:49483411-49483433 GGGGCTTGCCCAGAGTCACAGGG + Intergenic
1137790023 16:51167066-51167088 ATGACCTGCCCAAGGTCACATGG - Intergenic
1137816929 16:51407118-51407140 ATGACCTGCCCAAGGTCACATGG + Intergenic
1138204250 16:55113405-55113427 CAGCCCTGGCCAAGGTCAGATGG - Intergenic
1138297571 16:55900038-55900060 GGGGATTTCCCAAGGTCACAGGG + Intronic
1138345710 16:56318944-56318966 GTGTTCTGTCCAAGGTCACATGG + Intronic
1138351955 16:56350752-56350774 GGGCCCTTCCTATGGTCTCAGGG - Intronic
1138480267 16:57298126-57298148 GTGATCTACCCAAGGTCACACGG + Intergenic
1138522090 16:57576832-57576854 GGGCCCTGCCCCAGGCCACTGGG + Exonic
1138526230 16:57608972-57608994 GAGACTTGCCCAAGGTCACCCGG + Intergenic
1138536103 16:57661072-57661094 GGGGCCTGTGCAAGGTCACCTGG - Intronic
1138598925 16:58043693-58043715 AGGGCTTGCCCAAGGTCACCCGG + Intronic
1138944598 16:61833043-61833065 GTGACCTGCCCACGATCACATGG - Intronic
1139268613 16:65661925-65661947 GTGGCTTGCCGAAGGTCACATGG - Intergenic
1140641676 16:76980972-76980994 GGGACTTGCCCAAGGTCATATGG - Intergenic
1140836539 16:78799593-78799615 GGGACTTGGCCAAGGTCACATGG + Intronic
1140897988 16:79342143-79342165 GGGACTTGCCCAAAGTCACCCGG + Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141289106 16:82701236-82701258 GGGCCATGCCCAAGGTTGAAAGG - Intronic
1141431607 16:83973175-83973197 GGGCCCTGGGGCAGGTCACAGGG - Intronic
1141518441 16:84561940-84561962 GCATCCTGCCTAAGGTCACACGG + Intergenic
1141602291 16:85134152-85134174 GGGCACTGCCGAGGGTCACATGG - Intergenic
1141623446 16:85249282-85249304 GGCCCCTTCCCTAGGTCCCATGG + Intergenic
1141978293 16:87532971-87532993 TGGACCTGCCCAAGATCACTCGG - Intergenic
1141984461 16:87570926-87570948 GGGACTTGCCCAAGGTCACTCGG - Intergenic
1142047539 16:87935279-87935301 GGGCCTCGTTCAAGGTCACAAGG + Intronic
1142119928 16:88382254-88382276 GGAACCTGCCCAAGGCCACACGG - Intergenic
1142127925 16:88419425-88419447 AGAACCTGCCCAAGGTCACATGG - Intergenic
1142152063 16:88517013-88517035 GCGACCTGCCCCAGGTCACACGG - Intronic
1142198372 16:88749350-88749372 GGACCCTGCCCACGCTCTCAGGG - Intronic
1142480288 17:214807-214829 GGGGTCTGCTCAAGGTCACATGG + Intronic
1142616833 17:1141406-1141428 GTAGCTTGCCCAAGGTCACATGG - Intronic
1142950273 17:3472449-3472471 GTAACTTGCCCAAGGTCACAGGG - Intronic
1142972622 17:3623132-3623154 GGCCCCTACCCAAGGGCTCAGGG + Intronic
1144772976 17:17770000-17770022 GGGCCCTGCCCAGGGTGACAGGG + Intronic
1144810644 17:17996769-17996791 ATGCCTTGCCCAAAGTCACACGG - Intronic
1144947910 17:18979192-18979214 GGGCGCTGCCCATGGTTACATGG - Intronic
1145816305 17:27797456-27797478 GGGACTTGCCAAAGGTTACAGGG + Intronic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146287529 17:31584314-31584336 ATGACCTGTCCAAGGTCACATGG + Intergenic
1146522692 17:33538511-33538533 GGGGACTTACCAAGGTCACAAGG + Intronic
1146927220 17:36753379-36753401 CAGCCTTGCTCAAGGTCACAGGG + Intergenic
1146959097 17:36957208-36957230 GTAACTTGCCCAAGGTCACATGG - Intronic
1147217853 17:38911388-38911410 GGGACCTGCCCAAGGTCATCTGG - Intronic
1147575415 17:41596103-41596125 ATGGCCTGTCCAAGGTCACATGG - Intergenic
1147595288 17:41712719-41712741 GTGACTTGCCCAAAGTCACAGGG + Intronic
1147664319 17:42136514-42136536 GTGACTTGGCCAAGGTCACACGG - Intronic
1147789540 17:43004948-43004970 GAAACTTGCCCAAGGTCACAGGG - Intergenic
1148126354 17:45239190-45239212 GAGGCCTATCCAAGGTCACACGG - Intronic
1148196129 17:45714674-45714696 GTAACTTGCCCAAGGTCACACGG + Intergenic
1148678782 17:49460849-49460871 AGTCCCTGCCCAAGGGAACATGG - Intronic
1148693625 17:49546578-49546600 GGGCCTCTTCCAAGGTCACACGG + Intergenic
1148732309 17:49844958-49844980 GTGACTTGTCCAAGGTCACACGG + Intronic
1148786052 17:50146764-50146786 GCCCACTGCCCAAGGTCACATGG + Intronic
1148987670 17:51637738-51637760 GTGGGCTGCCCAAGGTCACAGGG + Intronic
1149044909 17:52233765-52233787 GGGCTCTGCCAAAGGGCATAAGG + Intergenic
1149867564 17:60159154-60159176 GGTGCCTGCCTGAGGTCACACGG + Intronic
1149995975 17:61406060-61406082 GGGACTTGCCAAAGGTCACACGG - Intronic
1150158106 17:62870984-62871006 AGGCCTTGCCAAAGGTCACCTGG - Intergenic
1150286885 17:63959680-63959702 GTGCCTTGCCCACTGTCACAAGG - Intronic
1150769531 17:68029510-68029532 GTGCCCTCCCCATGGTAACAAGG - Intergenic
1150943819 17:69723041-69723063 GTGCTTTGCCCAAAGTCACATGG - Intergenic
1151206695 17:72513154-72513176 GGGCCCTGCCCAGAGTCTCTTGG - Intergenic
1151350401 17:73528482-73528504 AGGATCTGCCCAAGGTCACTTGG + Intronic
1151665113 17:75541296-75541318 GGGCCCAGGCCAAGGTCACTGGG - Intronic
1151725038 17:75878628-75878650 GAGCCCTGGCCTAGGTCCCAGGG - Intergenic
1151880017 17:76889211-76889233 GTGGCTTTCCCAAGGTCACACGG - Intronic
1152025922 17:77809215-77809237 GGGCCTGACCCAAGGTCACAAGG + Intergenic
1152561678 17:81081846-81081868 GGGCCCTGCCCCACTCCACAGGG + Intronic
1152655012 17:81515207-81515229 GGGCCTCGCCCAAGGTCGCGCGG + Intronic
1152739069 17:82011239-82011261 GGCAGCAGCCCAAGGTCACAGGG + Intronic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1154111436 18:11571899-11571921 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1155185360 18:23382847-23382869 AGGCCCTGCCTAAGGGCTCAGGG + Intronic
1155773075 18:29724833-29724855 GGGCCAGGCCCAAGGTCTCTGGG - Intergenic
1156197209 18:34788501-34788523 GTGACTTGCCCAAGGTCATAGGG + Intronic
1157152921 18:45237393-45237415 GGATTTTGCCCAAGGTCACATGG + Intronic
1157221010 18:45828489-45828511 AGGCCTTGTCCAAGGTCACTCGG - Intronic
1157306427 18:46520884-46520906 ATGACTTGCCCAAGGTCACACGG + Intronic
1157584007 18:48789944-48789966 GTACCCTGCCCAAGGTCATGAGG - Intronic
1157689446 18:49668971-49668993 TGGCTCTGCCCAAGATAACAAGG - Intergenic
1157740958 18:50092384-50092406 GGGACAGGCCCAAGGTCACATGG + Intronic
1158226216 18:55204327-55204349 AGGCTTTGCCCAAGGTCACATGG - Intergenic
1158545745 18:58395002-58395024 GTAACTTGCCCAAGGTCACACGG - Intronic
1160156792 18:76441046-76441068 GGACCCTGGGCAAGGGCACAAGG + Intronic
1160422184 18:78754811-78754833 CTGTCCTGCCCCAGGTCACATGG + Intergenic
1160511416 18:79455554-79455576 GGGCCCTGCCCTGGTTCGCAGGG + Intronic
1160595641 18:79972260-79972282 GTACCCTGCCCAAGGTCACTTGG + Exonic
1160667546 19:339571-339593 GGACCCTGACCTGGGTCACATGG - Intronic
1160797543 19:952923-952945 GGGCAGTGCCCAAGGTCACAGGG - Intronic
1161039248 19:2101309-2101331 AGGTCCTGCCCAAGGGCACTGGG + Exonic
1161322010 19:3645705-3645727 GGTGCCTGCTCAAGGCCACATGG + Intronic
1161479300 19:4502695-4502717 GGAACCTGTCCAAAGTCACACGG - Exonic
1161612092 19:5248786-5248808 GGGACCTTCCCAAGGCCACTGGG - Intronic
1161617970 19:5282817-5282839 GGGACCTGCCTTTGGTCACACGG + Intronic
1161668140 19:5589468-5589490 GGACCCTGCCCAGCGCCACAGGG - Intronic
1161672862 19:5623749-5623771 GGGACTCGGCCAAGGTCACACGG + Intronic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1161952567 19:7475981-7476003 GGGGACTGCTCAGGGTCACACGG - Intergenic
1162349104 19:10138115-10138137 CAGCACTGCCCGAGGTCACATGG + Intronic
1162575416 19:11496203-11496225 GGGCTCAGCCCATGGTGACATGG + Intronic
1163039020 19:14588788-14588810 GGCCCCTGTCTAAGGTCACCAGG - Intronic
1163126132 19:15245204-15245226 GGGACTTGTCCAGGGTCACATGG + Intronic
1163630035 19:18413609-18413631 GGGCCCTTCCCCAGCTCCCATGG - Intergenic
1163703047 19:18796035-18796057 GGCACCTGCCAAAGGTCACACGG - Intergenic
1163827761 19:19533133-19533155 GGGGCCTGCCCTGGGTCAGAGGG + Intronic
1165717195 19:38053998-38054020 GGGACCTGTCCAAGGTCACACGG + Intronic
1166141979 19:40810147-40810169 GGGCCCTGCACAAGGCCACTAGG + Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166369818 19:42294466-42294488 GGGTCCTGCCCACAGTCACAGGG - Intronic
1166772495 19:45292356-45292378 GTTACTTGCCCAAGGTCACACGG - Intronic
1166831585 19:45642583-45642605 GGGACTTCCCCAAGGTCACACGG - Exonic
1166946614 19:46401147-46401169 GGGACCTCTCCAGGGTCACAAGG - Intergenic
1166977313 19:46612228-46612250 GGCATCTGCCCAAGGCCACAAGG - Intergenic
1167020674 19:46873047-46873069 GGGACTTGCCCAAGGCCACATGG + Intergenic
1167383634 19:49151985-49152007 GGGCCCCGCCCATGCTCACCTGG + Exonic
1168098701 19:54129401-54129423 GGGGCCTTGCCAAGGTCTCAGGG - Intronic
1168148479 19:54432447-54432469 GGGACCTTCCCAAGGTCACACGG + Intronic
1168160520 19:54507630-54507652 GGGCCTTGCTCAGGGTCACGTGG - Intronic
1168288529 19:55346170-55346192 GCGCCCTGGCCCAGGGCACAGGG - Intronic
1168497399 19:56864930-56864952 GGGCCCTGCGCAAGGGCGCCTGG + Intergenic
925026400 2:610575-610597 GGGTCCTGGGCAGGGTCACATGG - Intergenic
925297004 2:2783951-2783973 GGCCCTTGCTCGAGGTCACATGG - Intergenic
925349596 2:3191578-3191600 GGGCTCTGTCCAACTTCACAAGG + Intronic
925904687 2:8533419-8533441 GGACTTTGCCCAAGGTCACTTGG + Intergenic
926001816 2:9339352-9339374 GGAACCTGCCCAGTGTCACAGGG - Intronic
926063581 2:9820158-9820180 AGGACTTGCCCAAGGTCACGCGG + Intergenic
926084112 2:10010292-10010314 TGGCCCTGCTCAGGGGCACAAGG - Intergenic
926216860 2:10911404-10911426 GGGACTTGCCCAAGGTCACGCGG - Intergenic
926694898 2:15764337-15764359 GGGACTTCCCCAAGGTCACATGG + Intergenic
926729862 2:16028394-16028416 GAGTACTGCCCAAGGCCACAAGG + Intergenic
926806775 2:16718396-16718418 GGGGCTTGCCCAAGGACACACGG - Intergenic
927197904 2:20560678-20560700 GGGACTCACCCAAGGTCACATGG + Intronic
927855958 2:26528156-26528178 AGGACCTGCCCAAGGTCATGTGG + Intronic
927915656 2:26934447-26934469 GGGACCTGCCCAAGCTCACAGGG - Intronic
928180889 2:29067496-29067518 GGACGCTTCCCAAGGTCACGTGG - Intronic
928200391 2:29244235-29244257 GGGCCTTGCCCAGGATCCCACGG - Intronic
928228402 2:29475391-29475413 CTCTCCTGCCCAAGGTCACACGG + Intronic
928341043 2:30443581-30443603 GGGCCCTGCCTAAAGGGACAAGG + Intergenic
929464145 2:42129665-42129687 GGGTCCTGCCCCAGGACTCAGGG + Intergenic
929490048 2:42388020-42388042 GTGGCTTGCCCAATGTCACATGG - Intronic
929598612 2:43191373-43191395 GTGACCTGCCCAAGGTCACTGGG + Intergenic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930688691 2:54336454-54336476 GTGACTTGCCCAAAGTCACATGG - Intronic
930718473 2:54615605-54615627 GGAACCTGCCCAAGGGTACATGG + Intronic
930878784 2:56248830-56248852 GGTCACTGGCCAAGGTCATATGG + Intronic
931715841 2:65028030-65028052 GTGGCCGGCCCAAGGACACACGG - Intergenic
931779205 2:65565201-65565223 GAGCCCTGGCTCAGGTCACATGG - Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932046023 2:68350793-68350815 GTAACTTGCCCAAGGTCACATGG + Intergenic
932108246 2:68968922-68968944 TTGACCTGTCCAAGGTCACATGG - Intergenic
933183953 2:79258325-79258347 GGGAACTGCCCAAGGTCGCATGG - Intronic
933773842 2:85760018-85760040 TGGACCTGCCTAAGGTCACATGG + Intronic
933943944 2:87268141-87268163 TTGTCCTTCCCAAGGTCACAGGG - Intergenic
934603898 2:95679840-95679862 GGGACCTGCCCAAAGTCACAGGG - Intergenic
934665093 2:96164216-96164238 GGGCCCTGCCTGAGGCCACATGG - Intergenic
934713615 2:96530769-96530791 GGGCCCAGCCCCAGGTCATCAGG + Intergenic
934760058 2:96850023-96850045 ATGCCTTGCCCAAAGTCACAGGG + Intronic
936336276 2:111593438-111593460 TTGTCCTTCCCAAGGTCACAGGG + Intergenic
936537282 2:113322069-113322091 GGGACCTGCCCAAAGTCACAGGG - Intergenic
937084788 2:119164039-119164061 GGGCCCTGCCCAAGAAGAAAAGG - Intergenic
937198396 2:120180462-120180484 GGAACTTGCCCTAGGTCACATGG + Intergenic
938233223 2:129679753-129679775 GTAACTTGCCCAAGGTCACATGG + Intergenic
939011988 2:136857281-136857303 TGGCCATGCCCAGTGTCACATGG - Intronic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
941653731 2:168121219-168121241 AGGACCTGCCCAAAGTCACATGG - Intronic
942276060 2:174325031-174325053 AAGGCCCGCCCAAGGTCACAGGG + Intergenic
942868593 2:180707400-180707422 GAAACCTGCCCAAGGTTACATGG + Intergenic
944118953 2:196219889-196219911 GTACCTTGCCCAAGGTCTCAAGG + Intronic
945316986 2:208380015-208380037 GGGTCATGCCCATGTTCACACGG - Intronic
946046759 2:216827763-216827785 GGAACTTGCCCAAGGTCATATGG + Intergenic
946328097 2:218995100-218995122 GGGCCTTGTCCAAACTCACATGG + Intergenic
946368384 2:219265213-219265235 GTGTCCTGCCTGAGGTCACATGG - Intronic
946395240 2:219440740-219440762 GTTACTTGCCCAAGGTCACATGG - Intronic
946431661 2:219629722-219629744 GGGCCCAGCCCAGAGCCACAGGG + Intronic
946458119 2:219845639-219845661 ATGACCTGCCCAAGGTCACATGG - Intergenic
947635726 2:231680049-231680071 GGGGATTGCCCCAGGTCACACGG + Intergenic
948164989 2:235854249-235854271 AGGCCTTGTTCAAGGTCACATGG + Intronic
948184950 2:236013792-236013814 AGGCACAGCCCCAGGTCACAGGG - Intronic
948195306 2:236091263-236091285 GGGCCCTGCCCTCTGACACAGGG + Intronic
948321443 2:237072890-237072912 TGGCCTTGCTCAAGGTCACGCGG + Intergenic
948378877 2:237539775-237539797 GTGACCTGCCGAAGGTCACATGG + Intronic
948462664 2:238137898-238137920 AGGCCCTGACCAAGGTCAGGTGG - Intergenic
948853026 2:240717647-240717669 GCAGCCTGCCCAAGGGCACACGG + Intronic
1168762975 20:362368-362390 ATGCCATGTCCAAGGTCACAGGG - Intergenic
1168796481 20:613145-613167 GTGACTTGCCCGAGGTCACACGG + Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168833478 20:860521-860543 GTGATTTGCCCAAGGTCACATGG - Intergenic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168925695 20:1577344-1577366 GGGCCTTGTCCATGGTCACAGGG - Intronic
1168929577 20:1610370-1610392 GGGCCTTGTCCATGGTCACAGGG - Intronic
1168934093 20:1648023-1648045 GGGCCTTGTCCACAGTCACATGG - Intronic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1168942066 20:1721190-1721212 GGGTCTTGCCCACAGTCACAGGG - Intergenic
1169142773 20:3235562-3235584 GGGCCCTGGGTAAGGGCACATGG + Intronic
1169304356 20:4475477-4475499 GTGAGCTGCCCAAGGTCACTAGG - Intergenic
1169777949 20:9276590-9276612 GGGATTTGTCCAAGGTCACATGG + Intronic
1172030776 20:31980545-31980567 ATGACTTGCCCAAGGTCACATGG - Intronic
1172206514 20:33166586-33166608 GGTCTCTGGCCCAGGTCACATGG + Intronic
1172239217 20:33401227-33401249 GTGACCTGTCCAAGGTCACACGG + Intronic
1172331629 20:34079741-34079763 GAGACTTGCCCAAGGTTACATGG + Intronic
1172391215 20:34566692-34566714 GGGCCCTGCAAAAGGTCACATGG + Intronic
1172489988 20:35328562-35328584 AGACCTTGCCCAAGGTCACATGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172606624 20:36218515-36218537 TGGCTCTGCCCCAAGTCACATGG + Intronic
1172619758 20:36311206-36311228 GGTGGCTGCCCAAGGTCACTCGG + Intronic
1172647170 20:36477858-36477880 GGGACTTGCCCAAGGTCATACGG + Intronic
1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG + Intergenic
1172852968 20:37979891-37979913 ATGACTTGCCCAAGGTCACACGG + Intergenic
1172906995 20:38377813-38377835 GTGACCTTCCCAAGGCCACATGG - Intergenic
1172962122 20:38806591-38806613 GGGGTCTCCCCAAGGTCACCCGG + Intronic
1172973502 20:38890042-38890064 GTGACCTGCCTGAGGTCACATGG + Intronic
1173325733 20:42031675-42031697 ATGCCCTGTCCAAGGTCACATGG - Intergenic
1173421856 20:42908201-42908223 GTGACTTGTCCAAGGTCACATGG - Intronic
1173448126 20:43138419-43138441 GTGGCCTGCCCAGGGTCGCATGG - Intronic
1173523608 20:43716318-43716340 GTTCCCTCCCCAAGGCCACAGGG + Exonic
1173655091 20:44694636-44694658 TGACTTTGCCCAAGGTCACATGG - Intergenic
1173940535 20:46907429-46907451 GGGTCTTGCCCATGGCCACATGG + Intronic
1174045124 20:47727793-47727815 GGTCTCAGCTCAAGGTCACAAGG + Intronic
1174162399 20:48560907-48560929 GGGTCTTGCTCAAGGTCACGAGG - Intergenic
1174191408 20:48743178-48743200 AGGACTTGCCCAAGGTCACTGGG + Intronic
1174269138 20:49354338-49354360 GTGCCTTGCCCAAGGTCACATGG + Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174392453 20:50226389-50226411 GTGACTTGCCCCAGGTCACACGG - Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174657093 20:52180812-52180834 GTAACCTGCCCAAGGTCACATGG + Intronic
1174938564 20:54898602-54898624 TGGACCTGCCCTAGGTCAGAGGG + Intergenic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175252496 20:57617913-57617935 GGGCCCTGCCCAGGGTCTATTGG - Intronic
1175310799 20:58010547-58010569 AGGTCATGTCCAAGGTCACAGGG - Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175597981 20:60250614-60250636 GGGCCCTGCCCAGTGTCTAAAGG - Intergenic
1175914562 20:62419652-62419674 GGGCCCGGGCCAGGGCCACAGGG - Exonic
1178327426 21:31657211-31657233 AGGCCCTGCCCAGTGCCACAAGG - Intergenic
1178465972 21:32847927-32847949 GAGACCTGCCCATGGTCACTGGG + Intergenic
1178517908 21:33264289-33264311 GGGCCCTGCACAAGGAAACAGGG + Exonic
1178592292 21:33921565-33921587 GGTACTTGCCCAAGGCCACAGGG + Intergenic
1178681149 21:34672763-34672785 GTAACTTGCCCAAGGTCACACGG - Intronic
1179408190 21:41142556-41142578 GGACCTTGCCCAAGGCCACACGG + Intergenic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1179567267 21:42257143-42257165 GGAACTTGCCCAAGGTCACACGG + Intronic
1179568300 21:42262756-42262778 ATGACCTGCTCAAGGTCACACGG - Intronic
1179610291 21:42545806-42545828 GGCCACTGACCAAGGACACATGG - Intronic
1179655984 21:42845011-42845033 GGGCCCAGCCCAGGGTCACACGG + Intronic
1180023221 21:45142617-45142639 AGTCACTGCCCAAGGTCACATGG - Intronic
1180927480 22:19566365-19566387 GTAAACTGCCCAAGGTCACAGGG + Intergenic
1181015444 22:20066071-20066093 GGCCCCTGCCCATGGACAGATGG - Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181432289 22:22888763-22888785 GGGCCAGGCTCAAGGACACAGGG + Intronic
1181556858 22:23676125-23676147 GGGACCTGCCCAAAGCCACTCGG + Intergenic
1181601127 22:23952430-23952452 GGGACTTGCACAAGGCCACAGGG + Intergenic
1181697528 22:24601459-24601481 GGGACCTGCCCAAAGCCACTCGG - Intronic
1181748752 22:24974246-24974268 GAGACCTGCCCAATGTCACAAGG - Intronic
1181762813 22:25069593-25069615 GGGACTTGGCCAAGGTCACGCGG - Intronic
1181776285 22:25162040-25162062 CTGGCATGCCCAAGGTCACATGG - Intronic
1181815043 22:25431041-25431063 GGGGCCTGCCCAAGCTCACATGG + Intergenic
1181873372 22:25921127-25921149 TGGTCTTGTCCAAGGTCACACGG + Intronic
1181879266 22:25964816-25964838 GTGCTGTGCCCAAGGTCGCAGGG + Intronic
1181920344 22:26315614-26315636 GAGCCCAGCCCAAAGTCACATGG - Intronic
1181936912 22:26445601-26445623 GGGACTTGCCCAAGGTCCCGAGG - Intronic
1181964827 22:26649228-26649250 GTTCCCTACCCAAAGTCACATGG + Intergenic
1181993530 22:26856981-26857003 GTGACTAGCCCAAGGTCACACGG + Intergenic
1182038449 22:27217545-27217567 AAGACTTGCCCAAGGTCACACGG - Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182124684 22:27807914-27807936 GGAGCTTGCCCTAGGTCACACGG + Intergenic
1182355139 22:29719560-29719582 GGACGTTGACCAAGGTCACAGGG - Intergenic
1182442974 22:30374858-30374880 GTGAGCTGTCCAAGGTCACACGG - Exonic
1182520594 22:30882439-30882461 GGGACTCGCCCAAGGCCACAAGG - Intronic
1182639539 22:31755476-31755498 GGAGCTTGCCCAAGGTCACCAGG - Intronic
1182647135 22:31819294-31819316 GGCACCTGACCAAGGACACATGG - Intronic
1182766673 22:32762575-32762597 GTGACCTCCCCAAGGTCTCATGG - Intronic
1183016927 22:34996468-34996490 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1183106032 22:35615725-35615747 GAGACTTGTCCAAGGTCACATGG + Intronic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183215814 22:36479234-36479256 GTGGCCTGCCCAAGGCCACAGGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183520896 22:38295478-38295500 GGGGCCTGCTCATGGGCACAGGG + Intronic
1183529768 22:38347103-38347125 AGGCCTTGCCTAAGGTCACGTGG + Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183601878 22:38844468-38844490 GGCCTCTGTCCAAGGTCACCGGG + Intergenic
1183698011 22:39434074-39434096 AGTTACTGCCCAAGGTCACACGG - Intronic
1183730072 22:39613557-39613579 GTGACTTGCCCAAAGTCACATGG + Intronic
1184060022 22:42075706-42075728 GGAACTTGCCCAAGGTTACATGG - Intronic
1184101965 22:42345464-42345486 GTGACCTTGCCAAGGTCACAAGG + Intergenic
1184105617 22:42365928-42365950 GTGGCCTGCCCAGGGTCACCAGG + Intergenic
1184271494 22:43387073-43387095 GTGACCTGCCCAAGGGCACAAGG + Intergenic
1184399358 22:44264807-44264829 GGACCTCGTCCAAGGTCACATGG - Intronic
1184412669 22:44333781-44333803 GTGCCGTGCCCAAGGCCACCTGG - Intergenic
1184449986 22:44577056-44577078 GGGACTTGCTCAGGGTCACACGG - Intergenic
1184508398 22:44917801-44917823 GTGACCTGCCCAAGGCCACAGGG - Intronic
1184684913 22:46091886-46091908 GGGGCTGGCCCAAGATCACACGG - Intronic
1184924833 22:47629781-47629803 AGGACCTGCCCAGGGTCACTTGG - Intergenic
1185078105 22:48694096-48694118 GAAGTCTGCCCAAGGTCACACGG - Intronic
1185245262 22:49769880-49769902 GGGCCCTGCCTTGGGCCACATGG - Intergenic
949517706 3:4822075-4822097 GTGACTTGCCCAGGGTCACACGG - Intronic
949856431 3:8466103-8466125 GTGATCTACCCAAGGTCACACGG + Intergenic
949953200 3:9246533-9246555 ATGACTTGCCCAAGGTCACAAGG - Intronic
950016049 3:9755876-9755898 GTGACCTGGCCAAAGTCACATGG - Intronic
950197562 3:11019905-11019927 GTCTCTTGCCCAAGGTCACATGG + Intronic
950304031 3:11904714-11904736 GGCCCCTGCCCTAGGGTACAAGG + Intergenic
950438224 3:12993253-12993275 AGGGGCTGCCCAAGGTCACACGG + Intronic
950473115 3:13198688-13198710 GTGCCTTGCCCATGGTCACATGG - Intergenic
950523676 3:13510863-13510885 GTCACCTGTCCAAGGTCACATGG - Intergenic
950549387 3:13656935-13656957 GGGACTTGCCCAAAGCCACATGG + Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950567889 3:13781972-13781994 AGGACTTGCTCAAGGTCACACGG + Intergenic
950737849 3:15025051-15025073 GGCCCCTGCCCAAAGACAGAAGG - Intronic
950880189 3:16317016-16317038 GGGCCCTGTCCAAGAGGACAAGG - Exonic
951546128 3:23827530-23827552 GTACCTTGCCCAAGGTCACTAGG + Intronic
952307967 3:32162095-32162117 GTGACTTGCCCAAGGCCACAGGG - Intronic
952730898 3:36635597-36635619 GGGTCCACCCCAAGGACACAAGG + Intergenic
952744339 3:36763658-36763680 GTGCCTTGCCCAGGGTCACACGG - Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
953235239 3:41100806-41100828 GGAACCTGCCTAAGGCCACATGG + Intergenic
953556244 3:43948973-43948995 TTGGGCTGCCCAAGGTCACAGGG - Intergenic
954184750 3:48908372-48908394 GTTCCCTGCCCAAGGTCACATGG + Intergenic
954416340 3:50395305-50395327 GCAGCCTGCCCAAGGTCACATGG + Intronic
954423057 3:50428745-50428767 GGGACTTGCCCAAGGTCACTAGG + Intronic
954461512 3:50629576-50629598 ATGGCCTGCCCAAGGCCACAGGG + Intronic
954638525 3:52084704-52084726 GGGCCCTGGCCAAGGTGAGCAGG - Intronic
954658178 3:52210427-52210449 GGGTCTTGCCCAAAGTCATATGG - Intronic
954751468 3:52816607-52816629 GCTGCCTGCCCAGGGTCACAAGG + Intronic
955150181 3:56359566-56359588 GTGACTTGCCCAAGGCCACATGG + Intronic
955259259 3:57368477-57368499 GTACTCTGCCCAAGGTCCCAAGG + Intronic
955523026 3:59793470-59793492 CAGCCTTGCCCAAGGTCACATGG + Intronic
955741762 3:62098600-62098622 GTAACTTGCCCAAGGTCACATGG + Intronic
956091131 3:65668116-65668138 ATGCCTAGCCCAAGGTCACATGG - Intronic
956100201 3:65760344-65760366 GAAACTTGCCCAAGGTCACACGG + Intronic
956102116 3:65779358-65779380 GGGCTCAGCCCAAGGTAAGAAGG + Intronic
956780474 3:72599389-72599411 GCGCCCCGGCCAAGGTCCCAGGG - Intergenic
956906713 3:73773460-73773482 GGACCTTGACCATGGTCACATGG + Intergenic
959097780 3:101974282-101974304 GTGCCTGGCCTAAGGTCACATGG + Intergenic
960360993 3:116710942-116710964 GAGTGCTTCCCAAGGTCACATGG + Intronic
960536237 3:118817416-118817438 GTGGCTTGCCCATGGTCACACGG + Intergenic
960915488 3:122690250-122690272 GAGACATGCCCAAGGTCACATGG + Intronic
961002667 3:123384514-123384536 GGGCTCTTGCCCAGGTCACAAGG + Intronic
961379875 3:126490056-126490078 GTGACCTGCCCAAGGTCTCATGG - Intronic
961454201 3:127016202-127016224 GAGCCCTGGCCAGGGTCACCAGG + Intronic
961463707 3:127068882-127068904 GGGCTCAGCCCAGGGTCCCATGG + Intergenic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961633060 3:128315462-128315484 GGCCCTTGCTCAAGGCCACACGG + Intronic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
961647956 3:128402542-128402564 GTACCTTGCCCAAGGTCACACGG - Intronic
961658783 3:128457472-128457494 GAGACGTGCTCAAGGTCACAGGG - Intergenic
961986452 3:131139912-131139934 AGGCCCTGCCCAGGCTCTCATGG - Intronic
962286764 3:134092930-134092952 GGGGGCTTCCCAAGATCACACGG + Intronic
962835813 3:139187533-139187555 GAGCACTGCCCAAGGCCACCAGG - Intronic
963246949 3:143072506-143072528 GGGCAGGGCCCAGGGTCACAAGG + Intergenic
964014637 3:151929985-151930007 GGGTCCTGTTCAAGGTAACATGG - Intergenic
967290734 3:187917368-187917390 GTGCCTTGCACAAGGTCACTTGG - Intergenic
967412859 3:189184175-189184197 GGAGCTTGCCCAGGGTCACACGG - Intronic
967932051 3:194696998-194697020 GAAGCCTGCCCAAGGTCAAAGGG - Intergenic
967976830 3:195040224-195040246 GTGACTTGCCCAAGGTCACGCGG + Intergenic
968006943 3:195249578-195249600 GGTCCCTGCCCAGGGTGACTAGG + Intronic
968045279 3:195620481-195620503 GGGACTTGCCCAAGGTCACTCGG - Intergenic
968061134 3:195726824-195726846 GGGACTTGCCCAAGGTCACTCGG - Intronic
968065197 3:195754537-195754559 AGGCCCTGCCTAAAGCCACACGG + Intronic
968764507 4:2461256-2461278 GGGCCCTGGCCTAGTTCCCAGGG + Intronic
968872448 4:3248711-3248733 GGGCCCAGCCCCAGTTCAGAAGG + Exonic
969053835 4:4389505-4389527 GGGACATACCCAAGGTCACTGGG + Intronic
969134314 4:5017903-5017925 GGCACTTGCCCATGGTCACACGG - Intronic
969166429 4:5319814-5319836 GAGCTCTGCCCAAAGTCACAGGG + Intronic
969233535 4:5849073-5849095 GTTCCTTGCCCAAGGTCACATGG + Intronic
969289852 4:6231541-6231563 GGGCCATGCCCCAGCGCACAGGG - Intergenic
969292800 4:6251594-6251616 GTGACTTGCCCAAGGTCACCTGG - Intergenic
969485285 4:7468912-7468934 GTGACTTGTCCAAGGTCACACGG - Intronic
969657703 4:8507680-8507702 GGGTCCTGCCCCTGGTCACCTGG + Intergenic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
969845628 4:9918020-9918042 AGGCATTGCCCAAGGTCCCAGGG - Intronic
969869088 4:10093654-10093676 GTGACCTGGCCCAGGTCACATGG - Intronic
970991803 4:22221303-22221325 GGTCCCTGCCTGAGGTCAGACGG + Intergenic
971066469 4:23038498-23038520 GTGACTTGCCCAAGGTGACATGG + Intergenic
971240874 4:24887697-24887719 GGTCCCTGCCAGAGATCACAGGG - Intronic
972228671 4:37044750-37044772 GGGCACTGCCCAAGCTGATAGGG + Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
975391035 4:73817537-73817559 GGGAACTGTCCAAGGTGACAGGG + Intergenic
976001980 4:80385589-80385611 GTGACTTGCCCGAGGTCACAAGG + Intronic
976482161 4:85557364-85557386 GAGCCCTGCTCAAGCACACATGG - Intronic
977586424 4:98779935-98779957 GAGCCCTGCCAAAGTGCACATGG + Intergenic
977640013 4:99346893-99346915 AGGACTTGCACAAGGTCACAGGG - Intronic
978459464 4:108935039-108935061 GTGACTTGCCCAAGGTCAGACGG + Intronic
979459691 4:120967875-120967897 GTGACTTGACCAAGGTCACATGG + Intergenic
981922532 4:150100895-150100917 GGGCACTGCCCAAGATAACTGGG - Intronic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
985090897 4:186361682-186361704 TGGTCCTGGCCAAGGTGACATGG + Intergenic
986008142 5:3684991-3685013 GAGCCCCGCCCCGGGTCACAGGG - Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
987823130 5:22991604-22991626 TGGACCTGCCCTAGGTCAGAGGG + Intergenic
987861400 5:23492327-23492349 GGCCCCTGCCAAAGTTCACCAGG - Intergenic
988992670 5:36686827-36686849 GGGACTTGCTCAAGGCCACATGG - Exonic
989427829 5:41316597-41316619 TGGACCTGCCCAGGGTCAGAGGG + Intronic
989708934 5:44372882-44372904 GGGTCCTGCCTCAGGGCACATGG + Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
991493801 5:67208580-67208602 AGGGCCTGCCCAGGGTCTCAGGG - Intergenic
992029772 5:72709437-72709459 CAGCCCTGCCCAGGATCACAGGG + Intergenic
992117608 5:73555920-73555942 GTGTCTTGCCCAGGGTCACATGG - Intronic
993098913 5:83512272-83512294 GGGCCCTGGCCACAGTCACAGGG - Exonic
993879705 5:93348022-93348044 GGGACGTGGCCAAGGTCACGCGG + Intergenic
994163108 5:96579259-96579281 GGACCCTGCCCAGGGACACCAGG - Intronic
996591017 5:125147801-125147823 GGATGCTGCCCAAGGTCACATGG - Intergenic
997283965 5:132665249-132665271 GGGCCCCATCCAAGGGCACAGGG - Intergenic
997297144 5:132775530-132775552 ATAACCTGCCCAAGGTCACATGG + Intronic
997460796 5:134051027-134051049 GTGCCCTGCACAAGGGCACCTGG + Intergenic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
997623880 5:135318767-135318789 GGGACCTGCCCAAGTTCATATGG - Intronic
997668115 5:135648576-135648598 GGGACCTGCCCAGGCTCACATGG - Intergenic
997677571 5:135724641-135724663 AAGCCTTGCCTAAGGTCACAGGG + Intergenic
997726375 5:136123517-136123539 GGGCCCTGAGCAAGCTCAAAAGG - Intergenic
997752373 5:136358675-136358697 GGGACCTGCTCAAGGTCTCAAGG - Intronic
997779431 5:136641762-136641784 GGGACCTGTCCAGGGTCACTGGG - Intergenic
997815121 5:137009769-137009791 TAGACCTGCCCAAGGTCACAGGG - Intronic
998094216 5:139388246-139388268 GCCCCTGGCCCAAGGTCACAAGG + Intronic
998135467 5:139671928-139671950 GCCACCTGCCTAAGGTCACAAGG - Intronic
998151493 5:139759961-139759983 AGGCCTTGCCCAAGGTCACATGG + Intergenic
998381665 5:141730216-141730238 GGGCCATTCCCCAGGCCACAGGG - Intergenic
998393759 5:141805017-141805039 GAGCTTTGCCCAAGGTCACAGGG - Intergenic
998526292 5:142846259-142846281 GAGACCTTTCCAAGGTCACATGG + Intronic
998601766 5:143592114-143592136 TGCACCTGCCCAAGGTCACCTGG - Intergenic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
999253341 5:150195591-150195613 CGTCCTTGCCCAAGGTCACAGGG + Intronic
999255887 5:150209898-150209920 GGGACTTGCCCCAGGTCGCATGG + Exonic
999319769 5:150606675-150606697 GTGACCTGCCCACAGTCACAAGG + Intronic
999386613 5:151157986-151158008 GGGCTTTGGCCAAGGTCACGCGG + Intergenic
999437239 5:151572401-151572423 GAGACTTGCCCAAAGTCACAGGG + Intergenic
999681817 5:154067772-154067794 GGGGCTTGTCCAAGGTCACATGG - Intronic
999729438 5:154465334-154465356 GTGGCTTGCCCAAGGTCACCAGG + Intergenic
1000342147 5:160286094-160286116 TGGCCCGGCCAAAGGTCACTTGG - Intronic
1000899643 5:166897013-166897035 GTGACCCGCCCAAGGTCACAAGG + Intergenic
1001173191 5:169441231-169441253 GGGCCCAGTGCAATGTCACAGGG + Intergenic
1001405769 5:171476238-171476260 CAGGCTTGCCCAAGGTCACATGG + Intergenic
1001412413 5:171520540-171520562 AGGCCCTGCCCAAGGCCCCATGG - Intergenic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1001798497 5:174522883-174522905 TGGACCAGCCCAAGGTCACATGG + Intergenic
1001936415 5:175708961-175708983 GAGACGTGCCCAAGGTCATACGG - Intergenic
1001954189 5:175837152-175837174 GTGACCTGGTCAAGGTCACAGGG + Intronic
1001960569 5:175878285-175878307 GGGCCTTGCTGAAGGTCCCATGG + Intronic
1002133802 5:177096402-177096424 AGGCACTGCCCAAAGTCACGTGG + Intronic
1002181756 5:177434340-177434362 GCTCCTGGCCCAAGGTCACACGG - Intronic
1002372495 5:178766643-178766665 GGAGCTTGCCCAAGGTCACATGG - Intergenic
1002399050 5:178981092-178981114 AGGCCCTTCCCATGCTCACAGGG + Exonic
1002409250 5:179060980-179061002 GTGACCTGCCCAAAGTCATAAGG - Intronic
1003128349 6:3374012-3374034 AGTATCTGCCCAAGGTCACAAGG + Intronic
1004199912 6:13538537-13538559 GTGACTTGCCCAAGGTCATATGG - Intergenic
1005581318 6:27238000-27238022 GGACCCCTCCCAAGGTCAAAAGG - Intergenic
1006376161 6:33672771-33672793 GGTGCTTTCCCAAGGTCACAGGG + Intronic
1006440811 6:34052543-34052565 CTGCCCTGCTCAAGGTCTCACGG - Intronic
1006735409 6:36269636-36269658 GGGCACTGACCAAGGTCACAGGG + Intronic
1007072591 6:39048383-39048405 GGGACTTGTCCAAGGTCACACGG - Intergenic
1007234435 6:40380050-40380072 GGTCCCTGCCTAAGATAACAAGG - Intergenic
1007715338 6:43852322-43852344 GGTGCCTGGCCAAAGTCACAAGG + Intergenic
1007927532 6:45662544-45662566 GGGGCTTGCCCGAGGTCCCATGG + Intronic
1007953623 6:45896430-45896452 GAGCCTTGCTCAAGGGCACATGG + Intergenic
1008088513 6:47269088-47269110 GTGACTTGCCCAAAGTCACATGG - Intronic
1008210190 6:48712684-48712706 GTGACTTGCCCAAAGTCACAAGG + Intergenic
1008589891 6:52983550-52983572 GTGACCTGTCCAAGGTAACATGG - Intronic
1008895531 6:56549925-56549947 GTGACTTGTCCAAGGTCACACGG - Intronic
1010057194 6:71580187-71580209 GTAACTTGCCCAAGGTCACACGG + Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1013306307 6:108849834-108849856 AGGCATTGCCTAAGGTCACATGG + Intronic
1013397724 6:109759539-109759561 GAACATTGCCCAAGGTCACATGG + Intronic
1013585440 6:111574670-111574692 GGTCCCTGCCCAATACCACATGG + Intronic
1014153321 6:118084096-118084118 GTGACTTGCCCAGGGTCACATGG + Intronic
1014807527 6:125846783-125846805 GGCCATTTCCCAAGGTCACAGGG - Intronic
1017223538 6:151993780-151993802 GTGTCTTGCCCAAGGCCACACGG + Intronic
1017488840 6:154926427-154926449 CTGCCCTGCCCAAGTGCACAGGG + Intronic
1017679759 6:156851623-156851645 TGGGCCTGCCCAACGTAACATGG + Intronic
1017804460 6:157931775-157931797 CTGACTTGCCCAAGGTCACATGG - Intronic
1018002619 6:159593102-159593124 GAGACTTGCCCAAGGACACATGG - Intergenic
1018364471 6:163103873-163103895 ATGACTTGCCCAAGGTCACAGGG + Intronic
1019501301 7:1366211-1366233 GGGCTGGGACCAAGGTCACATGG + Intergenic
1019648177 7:2142016-2142038 GTGCGCTGCTCAAGGTGACAGGG - Intronic
1020035866 7:4962797-4962819 GGGACCTTCCCAAGGTCACAGGG + Intergenic
1020280701 7:6648630-6648652 AGGCCTTGCCCAAGGTCCTATGG + Intronic
1022377683 7:29829698-29829720 GTGACCTGACCAAGGCCACACGG + Intronic
1023254995 7:38304504-38304526 GTGCCCTGCTCAAAGTCACTTGG - Intergenic
1023863494 7:44228395-44228417 GGGCCCTGCCCATGGTGCCCAGG - Intronic
1023869656 7:44256211-44256233 GGGCCCTTCCCAGGGTCATCTGG + Intronic
1023912790 7:44567345-44567367 GGACCCTTCCCAATGCCACAGGG - Intronic
1024193224 7:47033696-47033718 GAGCCTTGCCCAAGGTCAAGAGG - Intergenic
1024230701 7:47361232-47361254 GGGCCCAGCCCAAGACCCCAAGG + Intronic
1024231409 7:47366725-47366747 GTGGCCTGCCCAGGTTCACATGG - Intronic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1026665716 7:72337956-72337978 GACCCCTGCCCCAGGTCTCAAGG + Intronic
1027055781 7:75048468-75048490 GGGGCTTGCCCCAGGTCTCACGG - Intronic
1027188092 7:75983678-75983700 TGGCCCTGCCCCAGGTCAGGAGG - Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1028655289 7:93198388-93198410 GAGTCTTGCCCAAGGTCACTTGG + Intronic
1029283491 7:99451267-99451289 AGTCCCTGGCCAAGGGCACATGG + Intronic
1029420139 7:100467936-100467958 GGGCCATGCCCAAGGGGAAAGGG + Intronic
1029587671 7:101485814-101485836 GGGACAATCCCAAGGTCACATGG - Intronic
1029666153 7:101996484-101996506 GGGCCCCCTCCATGGTCACATGG - Intronic
1030542322 7:110846238-110846260 GTGCCTTGGCCAAGGTAACATGG + Intronic
1031890248 7:127286109-127286131 GGGCTTTGCCCAGGGTCATACGG - Intergenic
1032476583 7:132215311-132215333 GGGGCTTGCCCAAGGCCAAATGG - Intronic
1032668124 7:134057882-134057904 GGTATTTGCCCAAGGTCACATGG + Intronic
1032684318 7:134216061-134216083 GTAACTTGCCCAAGGTCACATGG - Intronic
1033445518 7:141418338-141418360 GAGCCCTTGACAAGGTCACAGGG + Intronic
1034550887 7:151819960-151819982 GTGACGTGCCCAAGGTCACATGG + Intronic
1034840706 7:154392837-154392859 GGGCCCTCCCCAAAGTCCCATGG + Intronic
1035228245 7:157445365-157445387 GGGCCCTGCCCAAAGTCAGCTGG - Intergenic
1035274451 7:157739152-157739174 GGGACTCACCCAAGGTCACACGG + Intronic
1035648850 8:1248841-1248863 GGGACCTGCACACGGTCACCAGG + Intergenic
1037167172 8:15845260-15845282 GTGCCTTGCGCAGGGTCACATGG - Intergenic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1037761269 8:21743303-21743325 GGGCACTGCTCAAGGCCAGATGG + Intronic
1039064303 8:33595869-33595891 TGTGCCTGGCCAAGGTCACACGG - Intronic
1042545362 8:69946571-69946593 AGAGCCTGCTCAAGGTCACATGG - Intergenic
1042923424 8:73942197-73942219 GGGCCTTGTTCAAGGTCACATGG + Intronic
1044665889 8:94633993-94634015 GGAACATGCCCAAGGCCACAAGG + Intergenic
1044808424 8:96032503-96032525 GTGACAAGCCCAAGGTCACATGG + Intergenic
1046530899 8:115443614-115443636 TCAACCTGCCCAAGGTCACATGG - Intronic
1047325144 8:123828810-123828832 GCACTTTGCCCAAGGTCACATGG - Intergenic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1047751206 8:127882089-127882111 GGGATGTGCCCAAGGCCACACGG + Intergenic
1048163381 8:132040761-132040783 TTGCCCTTCCCAAGGTCTCAGGG + Intronic
1048251450 8:132869688-132869710 GGGCCCATCCCAGGGTCACCTGG + Intronic
1048255735 8:132903789-132903811 GGGACCAGCCCAAGGTCACCTGG - Intronic
1048458418 8:134599491-134599513 GTGACTTGCCCAAGGCCACAGGG + Intronic
1048543058 8:135360605-135360627 GTTACTTGCCCAAGGTCACACGG - Intergenic
1048717879 8:137287936-137287958 GAGGTCTCCCCAAGGTCACATGG - Intergenic
1048871334 8:138801900-138801922 GAAACCTGCCCAAGGTCACACGG + Intronic
1049013741 8:139905566-139905588 TGGCCATGACCAAGGTCACCCGG + Intronic
1049116560 8:140693640-140693662 TGCTCTTGCCCAAGGTCACATGG - Intronic
1049195620 8:141314127-141314149 GGGTCATACCCCAGGTCACATGG + Intergenic
1049255351 8:141610760-141610782 GGGCTCTGCTCAGGGTCCCATGG - Intergenic
1049367767 8:142248986-142249008 ATGTCCTGCCCAAGGCCACAGGG - Intronic
1049376865 8:142293524-142293546 GAGACCTGCCCAGGGTCACATGG + Intronic
1049726345 8:144148196-144148218 GGCGCCTCCCCAAGGTCACAGGG + Intronic
1049939915 9:535529-535551 GTGGTCTGCCCCAGGTCACAGGG + Intronic
1050807131 9:9694867-9694889 TGGACCTGACCAAGGTCAAAGGG - Intronic
1052338383 9:27341772-27341794 GTGACTTGCCCAAGGTTACATGG + Intronic
1052960419 9:34291390-34291412 GGGACTTGCCTAAGGTCATATGG - Intronic
1053293083 9:36894926-36894948 GTCACCTGCCCAAGGTCACACGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1053417095 9:37953638-37953660 GGGGTGTGCCCCAGGTCACACGG - Intronic
1053428351 9:38025778-38025800 GGGTCTTGCCCAGGGTCACCTGG + Intronic
1055057807 9:72039694-72039716 AAGCCCTGCCCAGGCTCACAGGG - Intergenic
1055058052 9:72041566-72041588 GGTCCTTGCCCAAGGTCACATGG + Intergenic
1055657378 9:78464866-78464888 GTGACTTGACCAAGGTCACAGGG + Intergenic
1056070535 9:82982213-82982235 GTGACATGTCCAAGGTCACAAGG + Exonic
1056509369 9:87288510-87288532 GGACCCTGCCCAGGGTAAGAGGG + Intergenic
1056559708 9:87719352-87719374 GGAGCTTGCCCAAGGGCACAGGG - Intergenic
1056566410 9:87776722-87776744 GGAGCTTGCCCAAGGGCACAGGG + Intergenic
1056815059 9:89795136-89795158 TGCCACTGCCCAAGGTCACCGGG - Intergenic
1056893966 9:90523459-90523481 AAGCCCTGGCTAAGGTCACAAGG + Intergenic
1057216222 9:93230319-93230341 AGGCCCTGCCCAAGGCTGCAGGG - Intronic
1057782981 9:98064996-98065018 GGCCCCTGCCCCAGGTTGCAGGG - Intronic
1057802600 9:98199259-98199281 GGGACATGTCCAAGGTCACATGG + Exonic
1057802961 9:98201096-98201118 GGGACCTGCCCAAGGTCTCTGGG + Intronic
1057880114 9:98786891-98786913 GGGACCTGCCCAGAGTCACTGGG - Intronic
1058813334 9:108661910-108661932 AGGCACTTCCCAAGGTCACCTGG + Intergenic
1059614157 9:115930792-115930814 GGGACTTGCTCTAGGTCACAGGG - Intergenic
1059659389 9:116386547-116386569 GGGACTTGCCCAAGTTCACTTGG + Intronic
1059781244 9:117530357-117530379 GTGACTTGCCCAAGGGCACACGG + Intergenic
1060017689 9:120100902-120100924 GTACCTTTCCCAAGGTCACATGG - Intergenic
1060025424 9:120166668-120166690 GTGACTTGGCCAAGGTCACAGGG - Intergenic
1060152322 9:121296606-121296628 GTGACTTGCCCAAGGTCACCAGG + Intronic
1060204717 9:121675691-121675713 GTCACCAGCCCAAGGTCACAGGG - Intronic
1060207861 9:121693189-121693211 GGGACCTGCCCAGCGTCACCAGG - Intronic
1060730867 9:126036185-126036207 GTGACCTGCCCACGGTCACCTGG + Intergenic
1060992220 9:127855743-127855765 GGGCCTTGTCCAAGGTCTCATGG - Intergenic
1061076163 9:128342834-128342856 AGGTCTTGCCCAAGGTCACTTGG + Intronic
1061137270 9:128742067-128742089 GGGCTGTGCCCAAAGTCACAGGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061249411 9:129417674-129417696 GTGATCTGCCCAAGGTCACCTGG - Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061418113 9:130458988-130459010 GGGCCCTGGCTGAGGACACACGG - Intronic
1061493160 9:130957242-130957264 GGGCCCAGTCCCAGGTGACAAGG - Intergenic
1061510549 9:131058443-131058465 TGGCCTTGCTCAAGGTCACATGG + Intronic
1061600742 9:131668523-131668545 GGACCTTGGCCAAGGTCACAGGG + Intronic
1061649356 9:132034468-132034490 GCGCTCTGTCCAAGGTCAAAGGG + Intronic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1061765206 9:132877564-132877586 GGGCCTCGCCCAAAGTCACACGG + Intronic
1061789891 9:133053662-133053684 GTGCCCTCACCAAGGTGACAGGG + Intronic
1061857230 9:133448956-133448978 GGCCCCTTCCCAAGGAGACAGGG + Intronic
1061885406 9:133588763-133588785 GGACCTTGCCCAGGGTCACCGGG + Intergenic
1061985096 9:134125994-134126016 GGGCCCAGCCCAATGTGACCTGG - Intergenic
1062011888 9:134271740-134271762 GTGCCCTGCTCAGGGTCTCACGG - Intergenic
1062044236 9:134417776-134417798 GGCACCTGCCCAGGGCCACACGG - Intronic
1062083651 9:134637502-134637524 GGGCCATGCCCCAGGTCACCAGG - Intergenic
1062381900 9:136290730-136290752 CGGCCCTGCCCCAGGTCCCGGGG - Exonic
1062431880 9:136529994-136530016 GGGCCCTGCCCTGGCTCCCAGGG + Intronic
1062562762 9:137149106-137149128 GGGCCCTGCCCAGCCTCACCTGG - Exonic
1062634435 9:137482787-137482809 GAGCCCTGGCGAAGGGCACATGG + Intronic
1203551541 Un_KI270743v1:167424-167446 GGGCCCAGCGCAAGGTCTGATGG + Intergenic
1187435567 X:19265754-19265776 GAGACCTGCTCAAGCTCACATGG - Intergenic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189272301 X:39760008-39760030 GGCACCTGCCCAAGGTCTCTGGG - Intergenic
1189714330 X:43849611-43849633 GTGCCCTGCCCAAGGGCATTCGG - Intronic
1190015061 X:46819688-46819710 GGGCACTGGTCAGGGTCACAAGG + Intergenic
1191608655 X:63088047-63088069 CCACCCTGCCCAAGGTAACAAGG + Intergenic
1191678468 X:63816282-63816304 CTGACTTGCCCAAGGTCACACGG - Intergenic
1191774854 X:64802461-64802483 TGGACCTGCCCTAGGTCAGAAGG + Intergenic
1191975914 X:66870729-66870751 GTGACTTGCCCAAGGTCATAAGG + Intergenic
1192154498 X:68733735-68733757 GAGACGTGCCCAAGGTCACTAGG + Intergenic
1192240083 X:69321693-69321715 GTGGCATGCCCAAAGTCACATGG - Intergenic
1192266600 X:69543064-69543086 AGAACTTGCCCAAGGTCACACGG + Intergenic
1192558512 X:72109345-72109367 TTGACTTGCCCAAGGTCACAGGG + Intergenic
1192709439 X:73564201-73564223 GCAACCTGACCAAGGTCACAGGG - Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1195412601 X:104584254-104584276 GGGACATGCTCAAGGTTACAGGG + Intronic
1195497520 X:105554134-105554156 GGGCCCTGCCCTACATCAGATGG + Intronic
1195702057 X:107712983-107713005 GTGACTTGCCCAAAGTCACATGG - Intergenic
1195707444 X:107748211-107748233 AAGTCTTGCCCAAGGTCACACGG - Intronic
1195782237 X:108479050-108479072 GGGCCCTGGCCATGGTGGCAGGG - Intronic
1196022254 X:111002717-111002739 GACACGTGCCCAAGGTCACACGG + Intronic
1197714050 X:129693529-129693551 GTGACCTGCCTAAGGTCACACGG - Intergenic
1198523119 X:137472783-137472805 GGGACATGCTCAAGGTCACACGG - Intergenic
1198642112 X:138767760-138767782 ATGCCCTGACCAAGGTCACATGG - Intronic
1199504239 X:148543509-148543531 GTGACTTGCCCAAGGCCACAGGG + Intronic
1199760234 X:150899064-150899086 GAGCCCTTCTCAAGGTCACCCGG - Intergenic
1200248865 X:154541707-154541729 GGGATCTGCCCAAGGACACAAGG + Intronic