ID: 1152781942

View in Genome Browser
Species Human (GRCh38)
Location 17:82230607-82230629
Sequence TGGCTCAGCGGTGGGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 218}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152781927_1152781942 16 Left 1152781927 17:82230568-82230590 CCCCTACTGGCCTGCAGTGACCC 0: 1
1: 0
2: 0
3: 17
4: 230
Right 1152781942 17:82230607-82230629 TGGCTCAGCGGTGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 218
1152781929_1152781942 14 Left 1152781929 17:82230570-82230592 CCTACTGGCCTGCAGTGACCCTT 0: 1
1: 0
2: 4
3: 21
4: 294
Right 1152781942 17:82230607-82230629 TGGCTCAGCGGTGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 218
1152781930_1152781942 6 Left 1152781930 17:82230578-82230600 CCTGCAGTGACCCTTATGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1152781942 17:82230607-82230629 TGGCTCAGCGGTGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 218
1152781934_1152781942 -4 Left 1152781934 17:82230588-82230610 CCCTTATGCCAGGCTCGGCTGGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1152781942 17:82230607-82230629 TGGCTCAGCGGTGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 218
1152781928_1152781942 15 Left 1152781928 17:82230569-82230591 CCCTACTGGCCTGCAGTGACCCT 0: 1
1: 1
2: 1
3: 19
4: 260
Right 1152781942 17:82230607-82230629 TGGCTCAGCGGTGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 218
1152781935_1152781942 -5 Left 1152781935 17:82230589-82230611 CCTTATGCCAGGCTCGGCTGGCT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1152781942 17:82230607-82230629 TGGCTCAGCGGTGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 218
1152781925_1152781942 18 Left 1152781925 17:82230566-82230588 CCCCCCTACTGGCCTGCAGTGAC 0: 1
1: 1
2: 0
3: 20
4: 199
Right 1152781942 17:82230607-82230629 TGGCTCAGCGGTGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 218
1152781926_1152781942 17 Left 1152781926 17:82230567-82230589 CCCCCTACTGGCCTGCAGTGACC 0: 1
1: 0
2: 0
3: 25
4: 381
Right 1152781942 17:82230607-82230629 TGGCTCAGCGGTGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 218
1152781924_1152781942 28 Left 1152781924 17:82230556-82230578 CCGGACGGGTCCCCCCTACTGGC 0: 1
1: 0
2: 1
3: 3
4: 98
Right 1152781942 17:82230607-82230629 TGGCTCAGCGGTGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152781942 Original CRISPR TGGCTCAGCGGTGGGTCCTG GGG Intronic
900337180 1:2170002-2170024 TGCTTCAGGGGTGGGGCCTGGGG - Intronic
901078382 1:6569777-6569799 TGGCCCAGCGCTGGGTCTTTCGG + Intronic
902304152 1:15524403-15524425 AGGCGCAGAGGTGCGTCCTGAGG - Intronic
902562957 1:17289427-17289449 TGACTCATCTGTGAGTCCTGGGG - Intergenic
904032736 1:27543294-27543316 TGGCTCCACGTTGGGCCCTGTGG - Intronic
904926890 1:34056503-34056525 TGGCTCAGCTGTGTGACCTTGGG + Intronic
905208360 1:36356045-36356067 TGTCTTAGCTGTGGGACCTGGGG + Intronic
905309267 1:37038095-37038117 TGGCTCACAGGTGGGTGGTGAGG + Intergenic
906265369 1:44424805-44424827 TGGCCCAGCGGAGGGTCTGGAGG + Intronic
907321667 1:53606502-53606524 TGTCTCTGCTGTGTGTCCTGCGG - Intronic
907373087 1:54015602-54015624 TGGCTCTGGGCTGGGCCCTGGGG - Intronic
908355882 1:63324234-63324256 GGGCTCGGCGGTGGGCGCTGGGG + Exonic
910745743 1:90572624-90572646 TGGCTCAGCAGTGAGTCATAGGG - Intergenic
911652323 1:100403811-100403833 AGGCTCAGCGCTGGCTCCTCAGG - Intronic
912384541 1:109264684-109264706 TGGCTCTGCTGTGTGACCTGGGG + Intronic
915357051 1:155261718-155261740 TGGATCACAGCTGGGTCCTGAGG + Exonic
915460260 1:156066200-156066222 GGGCTCAGCAGTGGGCTCTGGGG + Intronic
915507872 1:156368925-156368947 GGGCACAGCTGTGGGACCTGGGG - Intergenic
916791481 1:168129159-168129181 TGGGTCAGGGGTGGGTCATCAGG + Intronic
916870982 1:168914315-168914337 TGCCCCAGCAGTGGGTGCTGAGG - Intergenic
919978487 1:202628077-202628099 GGGCTCAGAGGTGGGTGCCGGGG + Intronic
920438878 1:205965426-205965448 TGGCCCAGCCGTGGGGCTTGGGG - Intergenic
921359881 1:214321502-214321524 TGGCTGAGAGGTGGGACCGGTGG - Intronic
922617625 1:226972194-226972216 TAGCTCTGTGGTGGTTCCTGGGG + Intronic
922849599 1:228721607-228721629 TGGTTCAGAGCTGTGTCCTGAGG + Intergenic
922958478 1:229625585-229625607 CTGCGCAGGGGTGGGTCCTGCGG - Intronic
924941178 1:248813168-248813190 TGGCTCAGTGATGTGTCCTCTGG - Intronic
1062905251 10:1175508-1175530 TGGCCCAGAAGTGGCTCCTGGGG - Intergenic
1063740095 10:8807930-8807952 ATGCCCAGAGGTGGGTCCTGAGG - Intergenic
1064600357 10:16986336-16986358 TCAGTCAGCAGTGGGTCCTGAGG - Intronic
1064639703 10:17403149-17403171 TGGCTCAGGCGTGAGTCCTTTGG + Intronic
1068576452 10:58689192-58689214 TGGCTCATGGGTGGAGCCTGTGG + Intronic
1069873542 10:71547717-71547739 TGGCTCAGTGGTGGGTGCAGAGG + Intronic
1070972866 10:80581865-80581887 TGGGTCAGGGGTGGGTCCTTTGG + Intronic
1071496394 10:86170248-86170270 TGGCTCTGAGGTGGCTGCTGCGG - Intronic
1071518516 10:86314875-86314897 TGGCTCTGTGATGGATCCTGGGG - Intronic
1072784868 10:98272700-98272722 TGGCTCAGAGGTGGGCCCTGGGG + Intergenic
1072804250 10:98414789-98414811 TGGCTCTGCTGTGTGGCCTGGGG - Intronic
1073603581 10:104870844-104870866 TGCCTCAGAGGTGGGTCCATTGG - Intronic
1074386127 10:113018037-113018059 TGGCACAGTGCTGGGTGCTGGGG + Intronic
1074891099 10:117737192-117737214 GGGCACAGTGGTGGGTGCTGGGG + Intergenic
1074923890 10:118047055-118047077 TGGCCCAGTGGCGGGTCCTAGGG + Intergenic
1075369904 10:121927490-121927512 GGGCTGACCGGTGGGTGCTGCGG - Intronic
1075790836 10:125083375-125083397 AGGCTCAGCAGTGGTGCCTGTGG - Intronic
1076563379 10:131381833-131381855 TGACTCTGGGGTGGGCCCTGGGG - Intergenic
1076775680 10:132696835-132696857 TGGCCCAGCCCTGGGTGCTGTGG - Intronic
1077047056 11:551318-551340 GGGCTCAGCAGTGGGTCCTCCGG - Intronic
1077112089 11:866357-866379 AGGCTCAGGGGAGGGTGCTGTGG + Intronic
1077308894 11:1879864-1879886 TGGCCCAGGCGAGGGTCCTGGGG - Intronic
1077395665 11:2319917-2319939 TCCCACAGGGGTGGGTCCTGTGG + Intergenic
1077412226 11:2408994-2409016 TTGCCCTGCGGTGGGTTCTGGGG + Intronic
1077432719 11:2523971-2523993 TGGCTGAACGGTGGCCCCTGAGG + Intronic
1077541578 11:3149049-3149071 TGGCTCTGTGGTGGGCCCAGTGG - Intronic
1077553698 11:3215758-3215780 GGGCTCAGCAGTGGGTGCCGGGG + Intergenic
1077898208 11:6469809-6469831 TGGAGCAGGGGTGGGTCCAGAGG + Intronic
1079124957 11:17712479-17712501 TGCCTCAGAGGTGAGCCCTGGGG - Intergenic
1081626639 11:44659897-44659919 TGGTTCTGGGGTGGGCCCTGAGG + Intergenic
1082819664 11:57536469-57536491 TGGCCCAGTGGTGGGGCTTGGGG + Intergenic
1083660460 11:64249588-64249610 AGGCTCTGGGGAGGGTCCTGTGG + Intergenic
1083881177 11:65548995-65549017 CGGCTCAGCTGTGTGACCTGGGG + Intronic
1084857823 11:72000205-72000227 GGGCTAAGGGGTGGGTGCTGAGG + Intronic
1088835394 11:113574364-113574386 GGGCTCAGCGCTGAGCCCTGTGG - Intergenic
1089525774 11:119095500-119095522 GGGCGCAGAGGTGTGTCCTGGGG - Intergenic
1090425527 11:126604611-126604633 TGGCTTACAGGTGTGTCCTGTGG + Intronic
1090461119 11:126892321-126892343 TGCTTCCACGGTGGGTCCTGAGG - Intronic
1091144053 11:133261825-133261847 TGGCTGAGCGGTGGCTCTAGTGG + Intronic
1091466850 12:692252-692274 TGGCCCAGCTGTGCCTCCTGGGG - Intergenic
1096614509 12:52824161-52824183 TGGCTCAGGTGTGAGGCCTGGGG - Intronic
1097193383 12:57230991-57231013 TGCCTCAGAGGTGGGACCTGGGG + Exonic
1101706544 12:107225810-107225832 TGGCTCAGCTCTGCTTCCTGGGG - Intergenic
1104973546 12:132542043-132542065 TGGCTCTGTGGCAGGTCCTGAGG + Intronic
1106438365 13:29743458-29743480 TGGCCCAGCGTTGTGTCCTCTGG + Intergenic
1111724525 13:91989073-91989095 TGGTTCAGCGGAGGGTAATGAGG - Intronic
1112335996 13:98516536-98516558 TGGGTCAGGTGTGGGTCATGTGG + Intronic
1113632667 13:111898859-111898881 TGGCTCAAAGGTGGGTTCTAAGG - Intergenic
1113767173 13:112888784-112888806 TTGCTCAGTGGCGGGTCCTGAGG + Intergenic
1113890498 13:113732787-113732809 TGGGTGAGCGGTGGCTCTTGTGG + Intronic
1115961272 14:38837794-38837816 TGGCTCAGGGATGGGGCGTGTGG - Intergenic
1118930405 14:70234992-70235014 TGGGTCAGAGGTAGGGCCTGAGG - Intergenic
1119260641 14:73236312-73236334 TTGCTCAGCTGTGAGTCCCGGGG - Intergenic
1120994408 14:90405723-90405745 GGGCTCAGAGGTTGGTGCTGGGG - Exonic
1122055239 14:99093662-99093684 TGGCCCTGTGGTGGGTGCTGGGG + Intergenic
1122506383 14:102234442-102234464 TGGCCCAGCGCTGGGTCTTTCGG - Intronic
1122812901 14:104297770-104297792 AGGCTGAGTGGTGGCTCCTGGGG + Intergenic
1122824804 14:104364428-104364450 TGGCTCAGAGTGGGGGCCTGAGG - Intergenic
1122886472 14:104712634-104712656 TGGCTCCAGGGTGGATCCTGGGG + Intronic
1124494114 15:30176016-30176038 GGGCTCAGAGGTGGGTGCCGGGG + Intergenic
1124749456 15:32362629-32362651 GGGCTCAGAGGTGGGTGCCGGGG - Intergenic
1126859354 15:52869258-52869280 TGGCACAGCGCTAGGTACTGGGG + Intergenic
1129176963 15:73847238-73847260 TGGCTCAGGGCTGGGTCCCAAGG + Intergenic
1130558952 15:84944025-84944047 TGGCTCAGGGGTGGGAGGTGTGG + Intronic
1131101083 15:89690664-89690686 GGGCTCAGGCGTGGGTCCTCTGG + Exonic
1132205780 15:99985125-99985147 TGGCCCAGCGGCGGGCTCTGTGG + Intronic
1132236641 15:100227096-100227118 GTGCTCAGAGGTGGGGCCTGAGG - Intronic
1132335920 15:101048698-101048720 TGGCCCCGCGGTGGCTGCTGTGG - Intronic
1132517906 16:374445-374467 TGGGTGAGGGGTGGGCCCTGAGG - Intronic
1132581070 16:684886-684908 TGGCGCAGCGGTGGCACCTGGGG + Exonic
1132633694 16:932261-932283 ATCCTCAGCGATGGGTCCTGTGG + Intronic
1132668028 16:1090764-1090786 TGGCCCAGTGGTGGGTGGTGGGG + Intronic
1132814426 16:1818980-1819002 GGGCCCAGGGGTGGGTGCTGGGG - Intronic
1133148745 16:3810553-3810575 TGGCTCTCCGGTGGGTGCTGTGG - Intronic
1133418882 16:5628627-5628649 TGTCTCAGCTGTGGGTTCTTGGG - Intergenic
1135173617 16:20208843-20208865 TGGCTGAGGGGTGGGTATTGAGG + Intergenic
1135221908 16:20621332-20621354 TGGCCCAGGGTAGGGTCCTGGGG + Intronic
1136577985 16:31135475-31135497 TGGCCCAGAAGGGGGTCCTGGGG - Exonic
1139872534 16:70118956-70118978 TGGAGCATCTGTGGGTCCTGTGG + Intronic
1140363241 16:74362356-74362378 TGGAGCATCTGTGGGTCCTGTGG - Intergenic
1141077143 16:81016974-81016996 TGGCTCAAATGTGGGTCCTGTGG + Intronic
1142056743 16:88002405-88002427 TGGCCCTGCGCTGGCTCCTGGGG + Intronic
1142133855 16:88442793-88442815 TGGGGCAGCGGTGGGTCACGGGG + Intergenic
1142172965 16:88632398-88632420 AGCAGCAGCGGTGGGTCCTGGGG - Intergenic
1142303279 16:89271153-89271175 CGGCTCACAGGTGGGGCCTGCGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142509774 17:386108-386130 CGGCTCAGCGGCGGGGCCGGCGG - Intronic
1143187716 17:5020582-5020604 TGGCTCAGAGGGCGGTCCTGGGG - Exonic
1143368774 17:6425505-6425527 TGGCTCTGCAGGGGGCCCTGCGG + Exonic
1144678962 17:17180192-17180214 TGGCTCAGTGCTGGGCCCTGGGG - Intronic
1147433413 17:40389587-40389609 TGACTCAGCTGTGGCTCCTCGGG - Exonic
1147549386 17:41428697-41428719 TGGGTCAGCTGTGGCTCCAGCGG + Intergenic
1148340277 17:46869289-46869311 TGCCTCTGGGGTGGGGCCTGAGG + Intronic
1148837702 17:50474633-50474655 TGGCTCAGAACTGGGTGCTGGGG - Exonic
1149459082 17:56812601-56812623 TGGCTCAGCAATAGGTTCTGAGG + Intronic
1151604992 17:75130420-75130442 CGGCTCTGCGGTGGCCCCTGTGG + Exonic
1151786964 17:76279742-76279764 TGTCTCAGCTCTGGGTACTGAGG + Intronic
1152781942 17:82230607-82230629 TGGCTCAGCGGTGGGTCCTGGGG + Intronic
1153309284 18:3662376-3662398 GGGCTCAGAGTTGGGTGCTGTGG - Intronic
1160434811 18:78841592-78841614 TGGCTCCGTGGTGCTTCCTGGGG + Intergenic
1160764037 19:799148-799170 TGGTCCAGAGGTGGGGCCTGGGG + Intronic
1160849201 19:1181984-1182006 TGGGTCAGGGCTGTGTCCTGAGG + Intronic
1161618577 19:5286316-5286338 TGGAGCAGGGGAGGGTCCTGCGG + Intronic
1162133783 19:8543390-8543412 TGGCTCACAGGAGGGGCCTGGGG + Intronic
1163883097 19:19944596-19944618 TGGCTCAGCGCTGGGTCTTTTGG - Intergenic
1164720793 19:30430368-30430390 TGGCTCTGTGTTGGGTGCTGGGG + Intronic
1165023859 19:32945313-32945335 TGGCTCAGGGCTGGGCCCAGAGG - Intronic
1165478858 19:36049556-36049578 TGACTCAGGGGTAGGCCCTGAGG + Intronic
1165826155 19:38706970-38706992 TGGCTCTGGGGGCGGTCCTGAGG + Intronic
1166745922 19:45141847-45141869 AGGCTCAGCCTGGGGTCCTGTGG - Intronic
1167713131 19:51124563-51124585 TAGCTCAGAGGTGGGACTTGGGG - Intergenic
1167746834 19:51356595-51356617 TGGCTCTGAGCTGGATCCTGGGG + Exonic
925975459 2:9138977-9138999 TGGCCCAGCGGGGGAGCCTGAGG - Intergenic
928126527 2:28620429-28620451 TGTCTCAGCGCTGGGACCTGGGG - Intronic
929916625 2:46142171-46142193 TGGCTCAGGGGTGGGTGTAGGGG - Intronic
931041923 2:58310509-58310531 TTGCTCAGAGGTGGGTGCTGTGG + Intergenic
935777821 2:106487841-106487863 TGGCCAGGCCGTGGGTCCTGTGG + Intergenic
937132564 2:119524338-119524360 TGGCTCAGCCATGGCTCCTCGGG - Exonic
941811134 2:169756995-169757017 GGGCACACTGGTGGGTCCTGAGG - Intronic
946415123 2:219536388-219536410 AGGCTCAGTGCTGGGTTCTGTGG + Intronic
946436508 2:219659872-219659894 TGGCACAGCGGAGGGGGCTGGGG - Intergenic
948428401 2:237902560-237902582 TGCCTCAGAGTTGGGTCCCGCGG + Intronic
948763496 2:240207787-240207809 TTGCTCAGCAGTCAGTCCTGTGG + Intergenic
948789520 2:240370106-240370128 TGGCCCTGCGGTGGGGGCTGTGG + Intergenic
948900317 2:240953484-240953506 TGGTTCTGCTGTGGGTCCAGGGG - Intronic
1168814327 20:726459-726481 AGGCTCAGAGGTGGGCTCTGGGG - Intergenic
1170736481 20:19017615-19017637 AGGCTCAGCTGTTGGTCCTCTGG + Intergenic
1170787944 20:19483674-19483696 AGGCTCAGCTAAGGGTCCTGAGG + Intronic
1171077745 20:22146494-22146516 TGGCTCAGAGCTGGGACATGTGG + Intergenic
1171143475 20:22762807-22762829 TGGCTCACAGCTGTGTCCTGGGG + Intergenic
1172767794 20:37359979-37360001 TGGCTCAGCGATGGGTTCATGGG - Intronic
1173759176 20:45544895-45544917 AGGCTCAGTGGTGGGGCCTTGGG - Intronic
1175132047 20:56796627-56796649 GGGATCAGCCCTGGGTCCTGCGG - Intergenic
1175327976 20:58142846-58142868 TGGCTCTGAGGTGGGACCAGGGG - Intergenic
1175563991 20:59958391-59958413 TGGCTGAGCTGTTGTTCCTGAGG + Intergenic
1176132460 20:63502076-63502098 CAGCTCAGGGATGGGTCCTGGGG - Intergenic
1176722269 21:10402310-10402332 TGCCCCAGCGGAGGGCCCTGGGG + Intergenic
1179008847 21:37537640-37537662 TGGGGCTGCGGTGGGTTCTGAGG + Intergenic
1179512026 21:41879421-41879443 TGGCGCGGCCGGGGGTCCTGCGG + Exonic
1180106010 21:45618574-45618596 TGGCTCTGCGAGGAGTCCTGGGG + Intergenic
1180232279 21:46434369-46434391 AGGCTCAGCTGTGGGTCCTCTGG + Intronic
1180944162 22:19680558-19680580 TGGGTCAGGGGTGGGTGCGGCGG - Intergenic
1181172945 22:21020401-21020423 AGGCTCAGCGGTGTCTGCTGAGG - Intronic
1181821871 22:25482573-25482595 GGGCTCAGTGATTGGTCCTGAGG + Intergenic
953844813 3:46418808-46418830 TGGCTGTGCTGTGGGTCTTGTGG + Intergenic
954092608 3:48297066-48297088 GGTCTGAGTGGTGGGTCCTGTGG - Intronic
954166576 3:48764030-48764052 TTGGTCAGGTGTGGGTCCTGTGG - Intronic
954576292 3:51678166-51678188 TGCTTCTGCGGTGGGTGCTGGGG + Intronic
954622885 3:52005800-52005822 TGGCGCAGAGGAGGGGCCTGGGG + Intergenic
955364539 3:58299834-58299856 TGGCAGAGGGGTGGGTGCTGGGG + Intergenic
959661863 3:108878058-108878080 TGGCTCAGTCTTGGGTCGTGTGG - Intergenic
960592320 3:119378229-119378251 TGCCCCAGCTGTGGGTTCTGTGG + Intronic
963113062 3:141702285-141702307 TGGCCCAGCGCTGGGTCTTTTGG + Intergenic
964515993 3:157508350-157508372 TGGCTCAGCATTGGCACCTGTGG + Intronic
966313956 3:178625031-178625053 GGGCACAGGGGTGGCTCCTGGGG + Intronic
967945162 3:194798343-194798365 TGGCTCTGCTGTGTGACCTGGGG - Intergenic
968722296 4:2216606-2216628 TGGCTGAGCGCAGGATCCTGTGG + Intronic
968762875 4:2451408-2451430 AGGCTCAGAGGAGGGGCCTGGGG + Intronic
969405118 4:6986615-6986637 TTGCTCAGCCCTGGGACCTGGGG + Intronic
972345715 4:38190816-38190838 TGGCCCAGCTGTGGGGCCTGTGG + Intergenic
984146328 4:176065881-176065903 TGGCTCCGCGCTGGGGCTTGCGG + Intronic
985493856 5:193645-193667 GTGCCCTGCGGTGGGTCCTGAGG + Intronic
985569843 5:638951-638973 TGGCTCAGGGCTGGGGCCTCAGG + Intronic
987136540 5:14904715-14904737 CTTCTCAGCGGTGGTTCCTGGGG + Intergenic
988581043 5:32469041-32469063 CTGCTCAGCTGTGGGCCCTGAGG - Intergenic
990951162 5:61299832-61299854 TGTCTCAGCTGTGGGGCCTTTGG + Intergenic
992197464 5:74354211-74354233 TGGCTCAGTGGTAAGTCATGGGG - Intergenic
994592688 5:101791854-101791876 TGCCTCAGCTGTGGGTCAAGAGG - Intergenic
999279043 5:150352723-150352745 TGGCTCAGCTGTGTGACCTTGGG - Intergenic
1000011012 5:157232925-157232947 TGACTCAGCTGTGAGTCCAGAGG + Intronic
1000014593 5:157266172-157266194 TGGCTCTGCGGCGGGTCCAGGGG - Exonic
1002315771 5:178342088-178342110 TGGCTCAGAGCTGGGCACTGAGG - Intronic
1003028584 6:2580362-2580384 TGGCTCAGCCGTGGCTCAGGAGG - Intergenic
1003077158 6:2992593-2992615 TGACTGAGTGGTGGGCCCTGTGG - Intronic
1003828016 6:9974177-9974199 TGGCTCTGGGGTGGGGTCTGAGG + Intronic
1006009741 6:31032376-31032398 TGGCTCACGGGTGGATCCTGTGG - Exonic
1006843990 6:37050233-37050255 TGGCTCTGCTGAGGGCCCTGGGG + Intergenic
1013348861 6:109288383-109288405 TGGCTGAGAGGTGGGCCCTGGGG + Intergenic
1015471656 6:133612937-133612959 TAGCTCAGGGGTTGGCCCTGTGG - Intergenic
1017112866 6:150949124-150949146 TGGCAGAGAGGTGGGTGCTGGGG + Exonic
1020314771 7:6897726-6897748 AGGATCAGTGGTGGGCCCTGAGG - Intergenic
1020788291 7:12594844-12594866 TGGCCCAGCGCTGGGTCTTTTGG + Intronic
1024131745 7:46360522-46360544 AGGCTCAGCGGAGGGATCTGTGG + Intergenic
1024578007 7:50780596-50780618 TAGCTCAGAGCTGGGGCCTGGGG + Intronic
1025875384 7:65476469-65476491 TGGCCCAGCGCTGGGTCTTTTGG - Intergenic
1026025370 7:66740396-66740418 TGGCTCCGCGGCGACTCCTGGGG - Intronic
1026806733 7:73433783-73433805 TGGCTCAGCGGCGGCTCCGGTGG + Exonic
1032787420 7:135211673-135211695 TGGCTCAGGGGCGGGGCCTCGGG - Intergenic
1035051836 7:156003380-156003402 TGGGTGAGCAGTGGTTCCTGAGG + Intergenic
1035290905 7:157837816-157837838 GGACTCAGGGGTGGGTCCCGTGG + Intronic
1035530275 8:345741-345763 TAGCTCAGCGCTGGAACCTGTGG + Intergenic
1035788742 8:2284506-2284528 TGGTTCAGCGGCTGCTCCTGTGG + Intergenic
1035804063 8:2437199-2437221 TGGTTCAGCGGCTGCTCCTGTGG - Intergenic
1037989519 8:23310739-23310761 TGGGGCAGCAGTGTGTCCTGTGG - Intronic
1039267469 8:35841590-35841612 TGGCTCAGGGGTGGGCCTGGAGG - Intergenic
1040068808 8:43172488-43172510 TGGCTCAGAGGAGGCTGCTGGGG - Intronic
1040508788 8:48075338-48075360 TGACTCAGGGCTGGCTCCTGTGG + Intergenic
1043725743 8:83608677-83608699 TGGCTCAGTAGTGTGTCCTGTGG - Intergenic
1049096028 8:140548658-140548680 TGGCTCAGCGTGGGGCCCTGTGG + Intronic
1049529598 8:143147789-143147811 TGGCTTGGCTGTGGGTGCTGGGG - Intergenic
1052338865 9:27345811-27345833 TGTCTCAGCAGTGTGTGCTGTGG - Intronic
1053437968 9:38089813-38089835 TGGATGAGGGGAGGGTCCTGAGG + Intergenic
1056797538 9:89669153-89669175 TGGCTGAGCAGTGGGGCCTCAGG + Intergenic
1056962283 9:91136222-91136244 GGTCTCAGCTGTGGGACCTGAGG + Intergenic
1057384252 9:94593544-94593566 TGGCCCACCTGTGAGTCCTGGGG - Exonic
1061537290 9:131258003-131258025 TGGCTCAGCGGTGCTGGCTGCGG - Intergenic
1185706408 X:2270546-2270568 AGACTCAGCAGTGGGTCCCGCGG + Intronic
1187314724 X:18182714-18182736 TTGCTGAGAGGTGGGTGCTGAGG - Intronic
1189298206 X:39933963-39933985 AGGCTCTGAGCTGGGTCCTGGGG - Intergenic
1189990401 X:46588502-46588524 TGGCTCGGCTGAGGCTCCTGGGG - Intronic
1193698700 X:84739215-84739237 TGGCCCAGCGCTGGGTCTTTTGG - Intergenic
1199974122 X:152882589-152882611 TTTCTCAGCTTTGGGTCCTGGGG - Intergenic
1200081988 X:153581815-153581837 TGGCTCAGCACCAGGTCCTGAGG + Exonic
1201274860 Y:12287435-12287457 TGGCCCAGCGCTGGGTCTTTCGG + Intergenic