ID: 1152782055

View in Genome Browser
Species Human (GRCh38)
Location 17:82231019-82231041
Sequence CCGGGCTCCGCTGACCCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152782043_1152782055 13 Left 1152782043 17:82230983-82231005 CCTGTGGCTTCGAGGCCCCGACG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1152782040_1152782055 18 Left 1152782040 17:82230978-82231000 CCCGCCCTGTGGCTTCGAGGCCC 0: 1
1: 0
2: 1
3: 23
4: 226
Right 1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1152782051_1152782055 -10 Left 1152782051 17:82231006-82231028 CCTGGCGCGGCTCCCGGGCTCCG 0: 1
1: 0
2: 4
3: 26
4: 306
Right 1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1152782042_1152782055 14 Left 1152782042 17:82230982-82231004 CCCTGTGGCTTCGAGGCCCCGAC 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1152782041_1152782055 17 Left 1152782041 17:82230979-82231001 CCGCCCTGTGGCTTCGAGGCCCC 0: 1
1: 0
2: 2
3: 22
4: 227
Right 1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1152782039_1152782055 19 Left 1152782039 17:82230977-82230999 CCCCGCCCTGTGGCTTCGAGGCC 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1152782046_1152782055 -2 Left 1152782046 17:82230998-82231020 CCCCGACGCCTGGCGCGGCTCCC 0: 1
1: 0
2: 0
3: 16
4: 136
Right 1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1152782047_1152782055 -3 Left 1152782047 17:82230999-82231021 CCCGACGCCTGGCGCGGCTCCCG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1152782048_1152782055 -4 Left 1152782048 17:82231000-82231022 CCGACGCCTGGCGCGGCTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152782055 Original CRISPR CCGGGCTCCGCTGACCCCGG TGG Intronic
900180157 1:1307731-1307753 CCGGCCTGCGCCCACCCCGGCGG + Intronic
901055811 1:6448222-6448244 CAGGGCTCCGCGGAGCCCTGGGG + Intronic
902261098 1:15225444-15225466 CTGGGCTAGGCTGACCCCGGGGG - Intergenic
902478583 1:16700416-16700438 CAGGGCTCCGCGGAGCCCTGGGG - Intergenic
902733054 1:18382649-18382671 TTGGGCTCCACTGACCCCTGAGG + Intergenic
904618602 1:31762891-31762913 CCGGGCGCCCCTCCCCCCGGCGG + Intronic
912471133 1:109907722-109907744 CAGTGCTCAGCTGACCCCAGAGG - Intergenic
915498099 1:156295227-156295249 CAGGACTCCCCTGACCCTGGTGG + Intronic
922221101 1:223609241-223609263 CCGGGCCCGGCTGCCCCCTGGGG - Exonic
924002020 1:239564948-239564970 CAGGGCTGTGCTGTCCCCGGAGG + Intronic
1062982411 10:1736742-1736764 CCGGGCCCCGCAGTCCCCAGTGG - Intronic
1063138686 10:3238344-3238366 CTGGGCTCCGCAGACCCGGCAGG + Intergenic
1066252092 10:33644219-33644241 CCAGGCTCCTCTGACACTGGAGG - Intergenic
1076107319 10:127834041-127834063 CCTGGCTCAGCTGAGCCCAGGGG - Intergenic
1080802171 11:35618876-35618898 CCGGGCGCTGCTCACCCTGGCGG + Exonic
1081528522 11:43942878-43942900 CCCGGCCCCGCAGACGCCGGAGG + Exonic
1084517477 11:69644557-69644579 CCGGGCTCAGCTGAGCCCTGAGG + Intronic
1090558167 11:127898867-127898889 ACGGGCTCAGCAGACCCCGCGGG - Intergenic
1091996410 12:4997512-4997534 CCGGGGTCTTCTGACCCAGGGGG + Intergenic
1094473272 12:30822844-30822866 CCGGGCTCCTCTCTCCCCAGAGG + Intergenic
1095981554 12:47977354-47977376 CCTGGCTCCCCTGGCCCCGCTGG - Exonic
1096529332 12:52233372-52233394 CTGAGCTCCGCTCGCCCCGGCGG + Exonic
1100444721 12:94650226-94650248 CCGCCCTCCGCTGCCGCCGGAGG - Intronic
1101606085 12:106248230-106248252 CCGGCCTCCGCAGACCCCGCCGG - Intronic
1103013080 12:117472872-117472894 TGGGGCTCTGCTGACCCTGGAGG + Intronic
1105388700 13:19957581-19957603 CCTGACTCCGCTCCCCCCGGCGG + Intergenic
1105830642 13:24160842-24160864 CGGGGCTCCGCCGGCACCGGAGG + Intronic
1106597832 13:31161763-31161785 CCAGCCGCCGCTGTCCCCGGGGG - Exonic
1121104682 14:91272665-91272687 CCGGCCTCCCCGGAGCCCGGCGG - Exonic
1122672796 14:103385214-103385236 CGGGTCTCCGCTGACTCCCGCGG - Intergenic
1123002065 14:105301016-105301038 CCGGGCTGCGCTCACCGCCGTGG - Exonic
1123505584 15:20939763-20939785 CGGGGCTGCACTGCCCCCGGCGG - Intergenic
1124014324 15:25863062-25863084 CCGGGCTCCTCGGTCCCCGCCGG + Exonic
1125521504 15:40350376-40350398 CCGGTCCCCACTGACCCCTGTGG - Intergenic
1127267979 15:57376514-57376536 CCGGGCTCTGCTGGCTGCGGCGG + Exonic
1131074546 15:89486985-89487007 CCGGGCTGCACTGTCCCCGCAGG - Exonic
1132762954 16:1519853-1519875 CCTGTCCCCGCTGGCCCCGGGGG + Intronic
1132903008 16:2268485-2268507 CCGGGCTGTGCTGAGGCCGGCGG + Intergenic
1136153103 16:28365001-28365023 CAGGGCCGCGCTGACCCGGGTGG + Intergenic
1136365286 16:29806659-29806681 CCGGCCCCCGCTGAGCCCCGGGG + Exonic
1136534844 16:30893505-30893527 CCTGGCTCTGCGGACCCCTGGGG + Intronic
1141538386 16:84699682-84699704 CCGGGCTCCGGGGGCCCAGGTGG + Intergenic
1141684306 16:85561672-85561694 CCGGCCCCAGCTGCCCCCGGAGG + Intergenic
1141883034 16:86872481-86872503 CCCTGCTCGGCTGACCACGGAGG + Intergenic
1142225759 16:88876967-88876989 CCGTGCCCCGCTGACCCCACTGG - Exonic
1142763894 17:2055588-2055610 CCGGGCTCCCCTCCCCGCGGCGG - Intronic
1142977057 17:3651509-3651531 CCAGCCTCCGCTGGCCCCGAGGG - Intronic
1144855376 17:18264521-18264543 CCGGGGTCACCTGACCCAGGTGG + Exonic
1145236841 17:21214317-21214339 ACGGGCCCCGGCGACCCCGGGGG - Exonic
1145963762 17:28902722-28902744 CCGAGCTGAGCTGAGCCCGGCGG + Intronic
1146224092 17:31050864-31050886 CAGGGCTCAGGTGACCCCAGGGG + Intergenic
1146281949 17:31550269-31550291 CCGGGCTCCGCGGTCGGCGGGGG + Intergenic
1147331205 17:39700386-39700408 CCGGGCCCCTCTGGCCCCGCCGG - Intronic
1150802228 17:68291402-68291424 CCGGTCTCCGCCGGCCTCGGGGG + Intronic
1152146086 17:78569764-78569786 CCGGGGTCCCCTGTCCCTGGAGG - Intronic
1152390522 17:80001472-80001494 CCAGGCTGCGCTGGGCCCGGAGG + Intronic
1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG + Intronic
1153687369 18:7560005-7560027 CCGGGCTCTCCTGTCCCCAGGGG + Intergenic
1153872658 18:9334859-9334881 CCGGGCTCGGCCGACCCGGCGGG + Exonic
1155392155 18:25349755-25349777 CCGGGCCGCGCGGACCTCGGCGG + Intronic
1160567776 18:79797969-79797991 CCGGGCTCCGCTTACCCGGCCGG - Intergenic
1160823134 19:1067488-1067510 CCGGGCTCCACTCACCCCCGAGG - Intronic
1160986946 19:1843426-1843448 CTGGGCTTCCCTGACCCCAGTGG - Intronic
1161026179 19:2038442-2038464 GCAGGCTCCGCAGCCCCCGGGGG + Exonic
1161401187 19:4066751-4066773 GCGAGCGCCGCGGACCCCGGAGG - Exonic
1161703084 19:5805348-5805370 CCGGGCACCGCGGGCCCAGGCGG + Intergenic
1165067139 19:33235911-33235933 CGGGGCTCCGCAGGCCCCGTGGG + Intergenic
1165138389 19:33685014-33685036 CCGGGGTCCGCTGACCACGTGGG + Exonic
1165160216 19:33811586-33811608 GAGGGCTCCGCGGACGCCGGGGG - Intronic
1166294258 19:41881232-41881254 CCAGGCTCCCCTCACCCCAGCGG + Exonic
1167072283 19:47228119-47228141 CCCGGCTCCTATCACCCCGGGGG + Intronic
1168064050 19:53909409-53909431 GCGGGCACCGGCGACCCCGGTGG + Exonic
1202712602 1_KI270714v1_random:26247-26269 CAGGGCTCCGCGGAGCCCTGGGG - Intergenic
927887715 2:26728741-26728763 CCGGGCTCTGAGGACCCCTGGGG + Exonic
929033811 2:37672181-37672203 CCGGGCTCCGGTGGGCGCGGAGG + Exonic
936578479 2:113674913-113674935 ATGGGCTCCGATGACCCTGGCGG + Intergenic
938796182 2:134719376-134719398 GCGGGCTTCGCGGACCCCAGAGG - Intergenic
946712989 2:222525454-222525476 CCGGGCTCCTCTGACCTGGTGGG - Intronic
948582274 2:238996532-238996554 CCTGGCTCCCCTGTCCCTGGGGG + Intergenic
948645315 2:239400677-239400699 CGGGGCTGCGCTTACCGCGGCGG + Exonic
1170490126 20:16864027-16864049 CGGTGCTCGGCTGACCCCAGGGG - Intergenic
1171444872 20:25196039-25196061 CTGGGCTCCGCTGACCGGTGGGG + Intronic
1172516952 20:35541867-35541889 CCGGCCTCCGCTGTCCGGGGCGG - Intergenic
1173686106 20:44924384-44924406 TGGGGCTCTGCTGACCCCGTTGG + Intronic
1173741839 20:45407027-45407049 CTGGGCTCCGCGGCCCCCCGGGG + Intronic
1175119913 20:56709546-56709568 CCGGGCTGCGCTCCCTCCGGAGG + Intergenic
1175316987 20:58055301-58055323 CTGGGCTGGGCTGACCCCCGGGG + Intergenic
1177166662 21:17612249-17612271 CGCGGGTCCGCTGTCCCCGGCGG + Intronic
1178981469 21:37268100-37268122 CCGGGCTCCGCGGGCCGCGAGGG + Intergenic
1180296568 22:10942970-10942992 CCAGGCTCAGCTGACTCCAGAGG - Intergenic
1183393798 22:37560567-37560589 CCTGGCTCCGCGAGCCCCGGGGG - Exonic
1183439160 22:37813459-37813481 CCAGGCCCTGCTGACCCCAGAGG + Exonic
1183702426 22:39457788-39457810 CCGAGCTCCCCGGTCCCCGGAGG + Intronic
1183709804 22:39496292-39496314 CTGGGCACCGCTGACACCGCAGG + Intergenic
1184060300 22:42077473-42077495 CCGGGCCCCACTGAGCCTGGTGG + Exonic
1184130621 22:42514651-42514673 CGGGGCTCGGCCGACCCCGCGGG + Intronic
1184140800 22:42576481-42576503 CGGGGCTCGGCCGACCCCGCGGG + Intergenic
1184724464 22:46335577-46335599 CCGGCCTGCGCTCACCCCTGAGG - Exonic
1184759732 22:46537572-46537594 CCGCGCCGCGCAGACCCCGGCGG + Intergenic
1185055236 22:48575787-48575809 CCGGGCCGCGCGGACCCCGGCGG + Intronic
1185275251 22:49947875-49947897 CCAGGGTCCACTGGCCCCGGAGG - Intergenic
950316393 3:12004936-12004958 CCGGGCGCCGCCGCCCTCGGGGG + Intronic
950517898 3:13479628-13479650 CCTGGCTCAGCTTACCCCGGCGG + Intergenic
950522540 3:13505485-13505507 CAGGGGGCCGCTGACCCAGGTGG + Exonic
950583913 3:13879845-13879867 CCGGGCTGTGCTGATCCCGCGGG + Exonic
952736218 3:36694010-36694032 TTGGGCTCCTCTGACCCCGAAGG - Intergenic
953561785 3:43997969-43997991 CCGGGCTCTGCTGAGCGCTGCGG + Intergenic
954316844 3:49806028-49806050 CCGGGCTGGGCTGAGCCTGGGGG + Intronic
960115084 3:113885266-113885288 CCCGGCACCGCCGGCCCCGGAGG - Intronic
964525700 3:157613624-157613646 CCAGGCTCTGCTGACCCCTGCGG - Intronic
968512534 4:1001936-1001958 CCGGGCCGCGCTGACCCTGGTGG + Intronic
968626769 4:1629377-1629399 CCAGGCTCCGCTTTCCCTGGCGG - Intronic
968701884 4:2061314-2061336 CCCAGCCCCGCTGACACCGGAGG - Intronic
968965318 4:3766472-3766494 CTGGGCGCCGCGGTCCCCGGCGG + Exonic
969436676 4:7192860-7192882 CCGGGCTCCGCGCGCCCCGCGGG - Exonic
969716753 4:8871641-8871663 CCGGGCTCCTCGGTCCCCGCTGG + Exonic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
984834025 4:184002510-184002532 CCTGGCTCAGCTGACTCCTGGGG - Intronic
986030539 5:3889057-3889079 TCGGCCTCCTCAGACCCCGGAGG + Intergenic
994359983 5:98839643-98839665 CCGCGCGCCGCTGGCTCCGGGGG - Intergenic
997226253 5:132211522-132211544 CCAGGGTCTGCTAACCCCGGTGG + Intronic
997615289 5:135242016-135242038 CGTGGCTCCCCTGACCCCAGGGG - Intronic
998004726 5:138649372-138649394 CTGGGCTCCGCAGACTCTGGGGG + Intronic
1002047573 5:176550463-176550485 CTGGGCTCCGTTGATCCAGGAGG - Intronic
1006096700 6:31660737-31660759 CCGGGCTTCGCGGCTCCCGGCGG - Exonic
1014632442 6:123803603-123803625 CCCGGCTCCGCGGTCCCCGGCGG - Intergenic
1019324084 7:429524-429546 CTGGGATCCGCTGAGCCCTGGGG + Intergenic
1020085515 7:5308097-5308119 CCGTGCTCTGCTGAGCCCGCCGG - Exonic
1025208792 7:57009139-57009161 CCGTGCTCTGCTGAGCCCGCCGG + Intergenic
1025663157 7:63567731-63567753 CCGTGCTCTGCTGAGCCCGCCGG - Intergenic
1028871206 7:95772932-95772954 GCGTGCTCCGCTGAGCCCGAAGG + Intronic
1029409733 7:100401166-100401188 CCGGGAACCCCTGACCCAGGAGG - Exonic
1029552398 7:101244404-101244426 CCCGGAGCAGCTGACCCCGGCGG + Intronic
1029903943 7:104071857-104071879 ATGGGCTCCGCGGACCCGGGCGG + Intergenic
1031372856 7:120988636-120988658 CCGGGTTCCTCTGGCCCTGGGGG - Intergenic
1032068668 7:128791118-128791140 CTGGGCACAGCAGACCCCGGGGG + Intronic
1033662006 7:143408739-143408761 CTGCGCCCCGCTGCCCCCGGGGG - Exonic
1047208639 8:122822796-122822818 CCGGGCTCCGCGCCCACCGGAGG - Intronic
1049414195 8:142487952-142487974 CTGGGCTCCCCTGTCCCAGGAGG + Intronic
1049621102 8:143598666-143598688 CCGGGGTCCCCTGCGCCCGGGGG - Exonic
1049762197 8:144336652-144336674 CCCGGCGCCGCCGCCCCCGGGGG - Intergenic
1053577080 9:39364075-39364097 CCTGGCTCCGCTGTCACCGCTGG - Intergenic
1053841586 9:42192000-42192022 CCTGGCTCCGCTGTCACCGCTGG - Intergenic
1054098651 9:60922765-60922787 CCTGGCTCCGCTGTCACCGCTGG - Intergenic
1054120051 9:61198394-61198416 CCTGGCTCCGCTGTCACCGCTGG - Intergenic
1054587705 9:66984168-66984190 CCTGGCTCCGCTGTCACCGCTGG + Intergenic
1057533487 9:95875736-95875758 TCGGGCTCCGCCGCCGCCGGAGG - Exonic
1059405054 9:114094249-114094271 CCGGGCTCCACTGAGCCCTGAGG + Exonic
1061473042 9:130842644-130842666 CCGGGGTCAGCTGACACCAGAGG - Intronic
1062160183 9:135075622-135075644 CCCGGCTCCGCTGGCTCCGGCGG - Intronic
1185736600 X:2500772-2500794 CAGGGCTCCGGGGACCCGGGTGG - Intronic
1189974405 X:46447260-46447282 AAGTGCTCCGCTGACCCGGGAGG + Exonic
1191249951 X:58255527-58255549 CAGGGTTCCGGTGACCCCAGAGG + Intergenic