ID: 1152782827

View in Genome Browser
Species Human (GRCh38)
Location 17:82233788-82233810
Sequence GGGAACAGGACGCAGACTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152782827 Original CRISPR GGGAACAGGACGCAGACTGC GGG (reversed) Exonic
900464011 1:2815242-2815264 GAGCACAGGAGGCAGATTGCAGG - Intergenic
900548554 1:3242058-3242080 GGGAACAGGAGGGAGCCTCCCGG + Intronic
900925802 1:5705454-5705476 GTGCACAGGACACAGCCTGCAGG + Intergenic
902431535 1:16367286-16367308 GGGAAGAGGCGGCAGACAGCGGG + Exonic
902890698 1:19441268-19441290 GGGGACAGGTGGCACACTGCTGG + Intronic
904078626 1:27858215-27858237 GGGCACAGGGCCCAGCCTGCTGG - Intergenic
904265286 1:29315208-29315230 GGAGCCAGGACGCAGGCTGCTGG - Intronic
905227050 1:36485868-36485890 AGGAACAGGACTCAGCCAGCAGG - Intergenic
905533730 1:38702282-38702304 GGGAGCAGGAGGGAGACTGTGGG - Intergenic
905606250 1:39303020-39303042 GGGATGAGGAAGCAGACTGACGG - Exonic
905813804 1:40932290-40932312 GGGCAGAGGACACAGACTGAGGG - Intergenic
905990577 1:42334644-42334666 GGGAAGAAGCCGCAGAGTGCCGG + Intronic
907460018 1:54599932-54599954 GGGATCAGGAGCCAGGCTGCCGG + Intronic
909433365 1:75615208-75615230 GGGAGCAGGAAGTAGCCTGCAGG + Intergenic
909872668 1:80762980-80763002 GGGAAGAAGACTCAGACAGCAGG - Intergenic
912109710 1:106326107-106326129 AGGATCAGGAGCCAGACTGCAGG + Intergenic
912932862 1:113980297-113980319 GGGATCAGGAGGGAGGCTGCAGG - Intronic
914904615 1:151733597-151733619 AGGAACAGGAGGGAAACTGCTGG + Intergenic
917335128 1:173917924-173917946 GGGATCAGGAGACAGAATGCGGG + Intergenic
917611575 1:176693998-176694020 GAGAAAAGGAAGCAAACTGCAGG - Intronic
918249091 1:182685617-182685639 GGGAACAGGAGGCAGAGGGAGGG + Intergenic
920403489 1:205692151-205692173 GGGAAGCGGACACAGACTGGTGG - Intergenic
921255465 1:213334900-213334922 GGTAACAGGATGCACACTGAAGG + Intergenic
922792631 1:228318504-228318526 GGGAACAGGCCTCAGAGTGTGGG - Intronic
922880728 1:228978658-228978680 GGGGACAGGAAGCAGAGAGCAGG - Intergenic
923059361 1:230456181-230456203 GGGAAGAAGAGGCAGGCTGCTGG + Intergenic
1062999370 10:1900156-1900178 GGGAACAGGAGCCAGGCTGGGGG + Intergenic
1066315335 10:34240720-34240742 GGGAAAAGGAGGCTGACTCCTGG - Intronic
1069722598 10:70559364-70559386 GGGGACAGGAGGCAGACTGTGGG + Intronic
1069766834 10:70868356-70868378 GGGAACAGAAAGCATACTGATGG + Exonic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1074182975 10:111079062-111079084 GGGATCGGGACGCCGGCTGCAGG + Exonic
1074572995 10:114641783-114641805 GAGATCAGGAGGCAGACAGCAGG + Intronic
1074602417 10:114928811-114928833 GGGAACAGGATGCAGAGGCCTGG - Intergenic
1075797503 10:125131137-125131159 GGGAGCAGCCCGCAGAGTGCAGG + Intronic
1075936948 10:126350983-126351005 GGGAACATGGCCCAGACTGATGG - Intronic
1076196712 10:128523841-128523863 GGGAGCAGGGCTCAGAGTGCTGG - Intergenic
1076857010 10:133122310-133122332 GGGGCGAGGACGCAGACTGCAGG - Intronic
1081630309 11:44685050-44685072 GGGAACAAGAGGCTGGCTGCAGG + Intergenic
1085250607 11:75141170-75141192 GTGAACAGGAGGAAGGCTGCAGG + Intronic
1085446365 11:76603675-76603697 GGGAAAAGGACAGGGACTGCAGG + Intergenic
1087182449 11:95153130-95153152 GAGAAGAGGAAACAGACTGCAGG - Intergenic
1087917266 11:103825402-103825424 GGGAACAGGAGGCAGACTGCTGG + Intergenic
1089682859 11:120129159-120129181 AGGAAGAGGACACAGACTGTTGG + Intronic
1097052450 12:56231419-56231441 GAGAATGGGACGCTGACTGCAGG + Exonic
1097942921 12:65331991-65332013 GGGCACAGGAGACAGACTCCAGG - Intronic
1100668239 12:96779220-96779242 GGGAACATGATGTAGACTTCTGG - Intronic
1100892078 12:99136740-99136762 GGGAACAGGGAGAAGAATGCAGG + Intronic
1103211363 12:119169239-119169261 GGGAGCAGGAGGAAGACTGGAGG - Intergenic
1103557120 12:121773414-121773436 AGGAACTGGACGCAGCCTGCAGG - Exonic
1104886281 12:132110828-132110850 GGGAGCAGGATGCAGGCTGTGGG + Intronic
1105707175 13:22975220-22975242 GGGAAAAGGAGTCAGGCTGCAGG + Intergenic
1106547067 13:30739965-30739987 GGGAACAGCACCAGGACTGCTGG - Intronic
1107623838 13:42261889-42261911 GGGAAAAGGAATCAGACTGCAGG - Intergenic
1111921408 13:94415313-94415335 GGGAAAAGGAGTCAGACCGCAGG + Intergenic
1121331900 14:93054998-93055020 GGGGACAGGAGGCAGGCTGGCGG - Intronic
1121631044 14:95422193-95422215 GAGAACAGCTCGCAGACAGCAGG - Intronic
1121791543 14:96703050-96703072 GGGCACAGGGGACAGACTGCAGG + Intergenic
1122665177 14:103324745-103324767 GGAAACAGAACGCAGCCTGCTGG + Intergenic
1122851107 14:104531705-104531727 GGGAAAAGGAGTCAGGCTGCAGG + Intronic
1124205233 15:27712907-27712929 GGGAAGAGGAGGCAGCCTGCTGG + Intergenic
1125921116 15:43526545-43526567 TGGAACAGGACACATACTGGAGG + Exonic
1128712310 15:69881367-69881389 GGGAATAGCACGCAGGGTGCAGG - Intergenic
1128756977 15:70189838-70189860 TGGTACAGGAGGAAGACTGCAGG - Intergenic
1129220419 15:74128908-74128930 GGGAGAAGGAGGCAGACGGCGGG - Intronic
1131707879 15:95018117-95018139 GGGACCAGGAGACAGAATGCTGG - Intergenic
1132570383 16:641654-641676 GGGCACCGCACTCAGACTGCTGG - Intronic
1133283705 16:4680957-4680979 GGGAACGGAAGTCAGACTGCGGG - Intronic
1134048779 16:11122150-11122172 GAGAGCAGGACACAGACAGCAGG - Intronic
1136147557 16:28324292-28324314 GGGAACAGGACCCAGATTCTGGG + Intergenic
1136394001 16:29983047-29983069 GCGAACAGGGCGTAGGCTGCTGG - Intronic
1137832005 16:51552888-51552910 AGGAACAGGACCCAGGCTTCTGG + Intergenic
1141627072 16:85266949-85266971 GGGGACAGGAGGGAGCCTGCAGG + Intergenic
1141804822 16:86335698-86335720 GGAAACAGGCTGGAGACTGCGGG - Intergenic
1142816876 17:2433412-2433434 GTGAGCAGGATGCTGACTGCAGG + Intronic
1144711191 17:17402687-17402709 AGAGACAGGAAGCAGACTGCTGG + Intergenic
1148468585 17:47879299-47879321 GAGCACAGGAAGCTGACTGCTGG + Intergenic
1148496648 17:48056926-48056948 GGGAATGGGAGGGAGACTGCAGG + Intronic
1150155299 17:62848164-62848186 GGGAACAGCACGTAGTGTGCTGG + Intergenic
1150305798 17:64084331-64084353 GGGAACAGGACACAGAATTATGG - Intronic
1152469727 17:80484017-80484039 GGGACAGGGCCGCAGACTGCAGG + Intergenic
1152782827 17:82233788-82233810 GGGAACAGGACGCAGACTGCGGG - Exonic
1153784573 18:8523207-8523229 GGGAACAGGACGGAAAATGTGGG - Intergenic
1157181103 18:45498881-45498903 GGGAACAGAAAGCTGACTGTGGG - Intronic
1157843696 18:50982765-50982787 GGCAACAGAAGGCAGAATGCAGG - Intronic
1158745486 18:60195451-60195473 GGGAGGAGGACTCTGACTGCAGG - Intergenic
1159440079 18:68466956-68466978 GGGAACAGCATGAAGACTTCTGG + Intergenic
1160521197 18:79509198-79509220 GGGAACAGGAAGTGGACGGCGGG - Intronic
1161468515 19:4445153-4445175 GGGAACAGGACCCATGCTGCAGG + Exonic
1161747230 19:6068484-6068506 GGGAAAAGGAAGCAGACAGAAGG + Intronic
1162729038 19:12706569-12706591 GGGTACAGGAGGCGGCCTGCAGG - Exonic
1163481412 19:17558809-17558831 GGGAACAGGACCCAGTTTACTGG - Intronic
1163686181 19:18713033-18713055 AGAGACAGGAAGCAGACTGCTGG - Intronic
1164159123 19:22615263-22615285 AGGAACAGAAGGAAGACTGCTGG + Intergenic
1165453043 19:35896275-35896297 AGGAAGAGAAGGCAGACTGCTGG + Intronic
1167498437 19:49832203-49832225 GGGAACAGGAAAGAGACAGCAGG - Intronic
1167515816 19:49922618-49922640 GTGGACAGGACTCAGGCTGCTGG - Intronic
1168342813 19:55635412-55635434 GGAGGCAGGACCCAGACTGCAGG + Intronic
925906645 2:8543787-8543809 TGGGAAAGGACGCAGGCTGCTGG - Intergenic
929893464 2:45937915-45937937 GGGATCTGGGAGCAGACTGCAGG + Intronic
929938823 2:46314968-46314990 GGGAGAAGGAGGCAGGCTGCTGG + Intronic
931867924 2:66432285-66432307 GGGAAGGGGTCGCAGACTGCCGG + Intergenic
932821942 2:74909048-74909070 GGGACCTGGCCGGAGACTGCCGG + Intergenic
935458219 2:103295556-103295578 GGGAACAGGTGGTAGTCTGCAGG + Intergenic
938277154 2:130037157-130037179 GGTAATAGGACGCAGACGGCGGG - Intergenic
938328124 2:130427930-130427952 GGTAATAGGACGCAGACGGTGGG - Intergenic
938361825 2:130693548-130693570 GGTAATAGGACGCAGACGGCGGG + Intergenic
938438230 2:131300232-131300254 GGTAATAGGACGCAGACGGCGGG + Intronic
940136286 2:150439769-150439791 GGGAACAGGCACAAGACTGCAGG - Intergenic
947850713 2:233285487-233285509 TGGAGCAGGGCGCAGGCTGCTGG + Intronic
948481828 2:238255041-238255063 GGGATCAGGAGCCAGACTTCTGG + Intronic
948641860 2:239379948-239379970 GGGAAGCGGATGCAGACTGCAGG + Intronic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1175652051 20:60733956-60733978 GGGAACAGGACTCAGGTTCCAGG - Intergenic
1176248698 20:64109828-64109850 GGGAAGAGGACCCAGACTCGTGG - Intergenic
1181007430 22:20020706-20020728 GAGACCAGGACGCAGTCTGAGGG + Intronic
1183615014 22:38938740-38938762 GGGGACAGGAGCCAGATTGCAGG + Intergenic
1184657962 22:45951570-45951592 GGGAACAGAAAGCAGACTGGTGG - Intronic
1185030835 22:48442100-48442122 GGGCTCAGGACTCAGACTCCTGG - Intergenic
949899226 3:8795935-8795957 GGGAACAGGACCCAGAACTCAGG + Intronic
950040608 3:9917070-9917092 GGGAACAGCCAGCAGCCTGCCGG + Intronic
950612135 3:14133530-14133552 GGGAACAGGAGACAGAGTGAGGG + Intronic
950711675 3:14817671-14817693 GGGAAGATGAAGCAGACTGCCGG - Intergenic
952204766 3:31170236-31170258 GTGAACAGGAAGCAGATTCCAGG - Intergenic
952942506 3:38454870-38454892 GGTAACGCGACGCAGACTGGTGG - Intronic
952985059 3:38771564-38771586 GGAAACAAGACACAGACTGAGGG + Intronic
959646952 3:108714048-108714070 GGGCACAGGAAGCAGATGGCAGG - Intergenic
959849504 3:111071208-111071230 GGAAGCTGGACGCAGCCTGCTGG - Intronic
961017614 3:123479781-123479803 GGGAAAGGGACCCAGCCTGCAGG + Intergenic
961602978 3:128075388-128075410 GGGAACAGGAGGCAGGGGGCAGG + Intronic
966451740 3:180071099-180071121 GGAAACAGGAAGTAGAATGCAGG - Intergenic
972306219 4:37832530-37832552 GGAAACAGGACAGAGACTGGAGG + Intronic
972765484 4:42150054-42150076 GGGAAAAGGACCCAAATTGCTGG + Intronic
976378398 4:84371692-84371714 GAGATCAGGAGTCAGACTGCCGG + Intergenic
977705557 4:100066613-100066635 GGGAAGTGGATGCAGACTGTGGG - Intergenic
980488753 4:133496844-133496866 GGGAGCAGGAGGCTGACTTCGGG - Intergenic
983271507 4:165567597-165567619 GGGAACTGCAGGCAGCCTGCAGG + Intergenic
985532193 5:440552-440574 GGCAACAGCACAGAGACTGCAGG - Intergenic
985553775 5:546283-546305 TGGAACAGGACCTAGCCTGCAGG - Intergenic
991486032 5:67138225-67138247 GGGAAGAGGAGGCATTCTGCTGG + Intronic
992782773 5:80143174-80143196 GAGGACAGGACTCAGCCTGCAGG - Exonic
995511795 5:112918043-112918065 GATAACAGGAGGCAGACTACTGG - Intronic
998416526 5:141950218-141950240 GGGACCAGGATGGAGACAGCAGG - Intronic
1001602090 5:172935403-172935425 TGAAACAGGAGGCAGCCTGCAGG + Intronic
1002566830 5:180116833-180116855 GGGAACAGGAGTCAGCCTGGCGG + Intronic
1003959605 6:11196772-11196794 GGGACCAGGATGCAAAATGCTGG + Intronic
1004162596 6:13228142-13228164 GGGATTAGAACCCAGACTGCTGG - Intronic
1005709244 6:28487673-28487695 GGGAAAAGGAGTCAGACTGGCGG - Intergenic
1006283149 6:33072316-33072338 TGGGACAGGATGCAGACTGAAGG + Intronic
1006894499 6:37458537-37458559 GGCAACAGGAAGGAGAATGCAGG - Intronic
1007279317 6:40698744-40698766 GGGTACAGGATGAAGACAGCTGG + Intergenic
1007906533 6:45467043-45467065 GGGAGCAGAAGCCAGACTGCAGG - Intronic
1016324072 6:142879818-142879840 GGAAACAGAACGCAGCCTGTGGG - Intronic
1016938438 6:149465773-149465795 GGGAAGAGGAAGCAGATCGCTGG + Intronic
1017757444 6:157541592-157541614 GGGAACATGACGCAGAATCACGG - Intronic
1018452920 6:163925573-163925595 GTGAACAGCAGGCAAACTGCAGG + Intergenic
1019162156 6:170075954-170075976 GGGAAGAGGCCACAGAGTGCTGG + Intergenic
1019317600 7:396744-396766 GTGAGCAGGATGCATACTGCAGG - Intergenic
1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG + Intronic
1019882002 7:3869567-3869589 GGGAAGAGGACGCAGCGGGCTGG - Intronic
1022960667 7:35423389-35423411 GAGATCAGGACACAGACTGAGGG - Intergenic
1023724054 7:43123845-43123867 GAGAGCAGGACACAGACTTCTGG - Intronic
1024687821 7:51766698-51766720 GGAAACAGGAGCTAGACTGCAGG + Intergenic
1027515298 7:79135158-79135180 GGGAACAGGACTAAGAATGGTGG + Intronic
1029929509 7:104356205-104356227 AAGAACAGAACGCAGACTCCAGG + Intronic
1034223331 7:149461577-149461599 GGCAACAGGACTCAGTATGCTGG + Intergenic
1034244558 7:149634716-149634738 GGGCACAGGACACAGGCAGCAGG + Intergenic
1034986895 7:155521886-155521908 GGGCACAGGTTGCAAACTGCAGG - Intronic
1035792172 8:2317112-2317134 GTGAACAGCACGCACCCTGCAGG - Intergenic
1035800633 8:2404593-2404615 GTGAACAGCACGCACCCTGCAGG + Intergenic
1035851017 8:2919276-2919298 GGCAACGGGAGGCAGACTGGGGG + Intergenic
1036060405 8:5311935-5311957 GGAAACAGGAAGCAGAATGGTGG - Intergenic
1041470960 8:58208619-58208641 GGGAACATGAGACAGACTGCAGG + Intergenic
1043499544 8:80838818-80838840 AGGAACAGGAGGCAGAGTGGAGG + Intronic
1047030487 8:120874041-120874063 GGGAAGAGGAAGCAAATTGCAGG - Intergenic
1047203745 8:122787025-122787047 AAGAACAGGAAGCAGACTGTGGG - Intronic
1047765665 8:127987956-127987978 GGGAACTGGACTCTGAGTGCAGG + Intergenic
1048138378 8:131768811-131768833 TGGATCAAGACCCAGACTGCAGG - Intergenic
1048335678 8:133500446-133500468 GGGAAAAGGACGCAAAGAGCAGG - Intronic
1053135710 9:35649325-35649347 GGGGACAGGACAGAGACAGCAGG + Exonic
1060300277 9:122371049-122371071 GGGTGCGGGACGCAGAGTGCAGG - Intronic
1060452518 9:123756536-123756558 GGGCACAGGAGGATGACTGCTGG - Intronic
1061189357 9:129072514-129072536 GGGAACAGGTCCAAGCCTGCCGG + Intergenic
1061294577 9:129670019-129670041 AGAGACAGGAAGCAGACTGCTGG - Intronic
1061527744 9:131181274-131181296 GGGAACAAGAGGAAGAATGCTGG + Intronic
1062649591 9:137568730-137568752 GGGAACAGAAAGAAGCCTGCAGG + Intronic
1185959569 X:4534089-4534111 GTGAACAGAAAGCAGACTGGAGG + Intergenic
1186944149 X:14546378-14546400 TGGAACAGGAAGCCGCCTGCTGG - Intronic
1195618220 X:106929519-106929541 GGGAACAGAAAGCAGGATGCAGG + Exonic
1199500279 X:148500340-148500362 GGGACCAGGACGCGGGCTTCGGG - Intergenic