ID: 1152784990

View in Genome Browser
Species Human (GRCh38)
Location 17:82243069-82243091
Sequence AGCTGTGTGTTGAAGTACAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152784990_1152784991 -8 Left 1152784990 17:82243069-82243091 CCTCTGTACTTCAACACACAGCT 0: 1
1: 0
2: 0
3: 12
4: 208
Right 1152784991 17:82243084-82243106 ACACAGCTCCCACCCGCTCAAGG 0: 1
1: 0
2: 0
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152784990 Original CRISPR AGCTGTGTGTTGAAGTACAG AGG (reversed) Exonic
901855321 1:12040902-12040924 AGCTGTGTGTTGCAGAACACTGG + Intergenic
904147170 1:28402373-28402395 ATCAGTCTGTTGAAGTTCAGGGG + Intronic
904697171 1:32337034-32337056 AGTTGTGTGTGGAGGTAAAGAGG - Intergenic
905907037 1:41626124-41626146 AGCTATGTGTGGAATTACTGAGG - Intronic
906561197 1:46758246-46758268 AGCTCTGTCTTGTAGTTCAGGGG + Intronic
907238083 1:53064993-53065015 AGGTGTGTGGGGAAGAACAGGGG - Intronic
907983699 1:59509534-59509556 GGGTGGGTGTTGAAGGACAGAGG - Intronic
908117016 1:60950468-60950490 TGCTGTTTGTTCAAGTTCAGAGG + Intronic
910923436 1:92373936-92373958 AGCTGTATGTAATAGTACAGGGG + Intronic
911788537 1:101981588-101981610 AGCTGTTATTTGAAGTTCAGGGG - Intronic
913601160 1:120422149-120422171 AACTGTGTGCTGGAGGACAGGGG - Intergenic
914085884 1:144454452-144454474 AACTGTGTGCTGGAGGACAGGGG + Intronic
914191781 1:145418432-145418454 AACTGTGTGCTGGAGGACAGGGG + Intergenic
914589706 1:149096433-149096455 AACTGTGTGCTGGAGGACAGGGG + Intronic
914857761 1:151364819-151364841 ATCTGTGTGGTGGGGTACAGGGG + Intronic
915022502 1:152794722-152794744 AGCTCTGTGTTGAAAAACGGAGG + Intronic
916648376 1:166811724-166811746 TGCTGTGTGCTGGAGTGCAGTGG - Intergenic
916667668 1:166981156-166981178 ACCTTTGTGTTGAAGTAGCGGGG + Intronic
919579419 1:199352654-199352676 AGCTGGGTTTTTAAGTAAAGTGG - Intergenic
920253113 1:204635682-204635704 AGCTCTGTCTTAAAGTGCAGTGG + Intronic
920254090 1:204642581-204642603 AGCTGTGTGGTGGAGCATAGAGG - Intronic
922092075 1:222405367-222405389 AGCAGTGTGTTGAAATACTGAGG + Intergenic
922954686 1:229589100-229589122 ATCTGTGGGTAGAAATACAGTGG - Intergenic
1063408395 10:5817543-5817565 AGCTGTATGAAGAAGTGCAGGGG - Intronic
1063839471 10:10053395-10053417 AGCTGGGGTTTGAAGTTCAGAGG - Intergenic
1063941592 10:11135471-11135493 AGCTAAGTGTTGAACTAGAGTGG - Intronic
1064158692 10:12925041-12925063 CTCTGTGTGTTGAAGGAGAGGGG + Intronic
1068260302 10:54571920-54571942 GGGTGTGAGTTGAAGAACAGTGG + Intronic
1069900263 10:71702797-71702819 AGCTGGGTCTTGAAGGACAGAGG + Intronic
1069961503 10:72081834-72081856 TGCTGTGGGTTCAAGTAAAGAGG - Intronic
1071366997 10:84909560-84909582 AGTTGGGTGTTGGAGTATAGTGG - Intergenic
1075654020 10:124149402-124149424 AGCTTTGTGTTCCAGCACAGAGG + Intergenic
1075835380 10:125448455-125448477 AGCTGAGATGTGAAGTACAGCGG - Intergenic
1076435421 10:130438028-130438050 TGCTGTGTTTTGCAGTAAAGTGG - Intergenic
1078139122 11:8679248-8679270 AGCTGTGTGTTTAAGTCATGTGG + Intergenic
1078665716 11:13323369-13323391 AGCTGCATGTTGAAGTGTAGTGG + Intronic
1079405375 11:20140600-20140622 AGCTGTGTGTTGAGGGAGAGAGG + Intergenic
1080647042 11:34195002-34195024 TGCTGTGTATTAGAGTACAGGGG + Intronic
1081561166 11:44218314-44218336 TGGTGTGTGTGGTAGTACAGGGG + Intronic
1081716538 11:45254516-45254538 AGCTGTGTGCAGAATCACAGTGG + Intronic
1084495872 11:69502749-69502771 AGTTGTGATTAGAAGTACAGAGG - Intergenic
1085437380 11:76519922-76519944 TGCTGTGTGTTGTGATACAGAGG + Intronic
1085459815 11:76686812-76686834 AGGTGTGGCTTCAAGTACAGTGG + Intergenic
1085648022 11:78240552-78240574 AGCTGTGTTTTGGGCTACAGAGG - Intronic
1086235576 11:84626312-84626334 TGTTGTGTCTTGAAGTAAAGAGG - Intronic
1086926473 11:92645895-92645917 AGCTCTGTGTTGAAGTGAATGGG + Intronic
1087136879 11:94730168-94730190 GGCTGTGTGTTGAACTAGGGAGG - Intronic
1087191018 11:95254533-95254555 AGCTGTGCTCTGAAGTGCAGGGG + Intergenic
1087445896 11:98253120-98253142 AACTTTGTGTTGAAGTTCTGAGG + Intergenic
1090133668 11:124171735-124171757 AGCTGTGTCATGAGGTAAAGAGG + Intergenic
1090567840 11:128015230-128015252 AGCTGTGTGTTTTAGGACTGGGG + Intergenic
1095249933 12:39967173-39967195 AGTTGAGTTTTGCAGTACAGTGG - Intronic
1095273236 12:40246878-40246900 AGGTGTGTGTTGAGGGGCAGAGG - Intronic
1096620204 12:52859785-52859807 TGCTGTGTGTTGCAGCAGAGTGG - Intergenic
1097155998 12:57012797-57012819 AGGAGTGTGTGGAGGTACAGTGG - Intronic
1099106394 12:78501982-78502004 ATGTGTGTGTGGAAATACAGAGG - Intergenic
1101934730 12:109048123-109048145 GGCTGTGTGGTGGAGTGCAGTGG + Intronic
1102971154 12:117167889-117167911 AGCTGTGTGATCAAGGCCAGGGG - Intronic
1103428942 12:120864755-120864777 TGCTGCGTGTTGAAGTACTGTGG - Intronic
1103874462 12:124116436-124116458 AGCTGTGTTTTGGAGAGCAGAGG + Intronic
1103985521 12:124764837-124764859 AGCTGTGTGCTGAAGAAGATTGG - Intergenic
1105557929 13:21463512-21463534 TGCTATGTTTTGGAGTACAGTGG - Intergenic
1105620072 13:22058146-22058168 AGCTGGGTTTTAAAGGACAGTGG + Intergenic
1106770507 13:32956974-32956996 AGCTGTCAGTGGAAGTTCAGTGG + Intergenic
1107020936 13:35750743-35750765 AGCATTGTGTTGAATAACAGTGG + Intergenic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1110914601 13:81006414-81006436 AGGACTGTGTTGAAGAACAGTGG + Intergenic
1112847402 13:103660946-103660968 AGGTATGTGTTGAAATAAAGTGG - Intergenic
1112956911 13:105072089-105072111 AGCTTTGTTTTGAACTGCAGAGG + Intergenic
1113104622 13:106759060-106759082 AGCTGAGTGATGGAGCACAGTGG - Intergenic
1113104630 13:106759111-106759133 AGCTGAGTGATGGAGCACAGTGG - Intergenic
1113104639 13:106759161-106759183 AGCTGAGTGATGGAGCACAGTGG - Intergenic
1113104668 13:106759314-106759336 AGCTGAGTGATGGAGCACAGTGG - Intergenic
1113104678 13:106759365-106759387 AGCTGAGTGATGGAGCACAGTGG - Intergenic
1113104687 13:106759415-106759437 AGCTGAGTGATGGAGCACAGTGG - Intergenic
1113104704 13:106759515-106759537 AGCTGAGTGATGGAGCACAGTGG - Intergenic
1114595672 14:23909685-23909707 TGCTGTGTGTTGAGGAACTGAGG - Intergenic
1114742422 14:25111431-25111453 AGATGTGTGATGCAGTTCAGTGG + Intergenic
1115432593 14:33337049-33337071 AGGTGTTTTTTGAAGAACAGAGG + Intronic
1116435373 14:44889967-44889989 AGTTGTGGCTTGAAGAACAGAGG - Intergenic
1120076467 14:80164482-80164504 AGCTGGGTCATGAAGGACAGTGG + Intergenic
1120697808 14:87664065-87664087 AGTAGTGTGTTGAATGACAGTGG - Intergenic
1120853138 14:89188616-89188638 AGCTGGTTGCTGAAGTTCAGAGG - Intronic
1121328500 14:93035403-93035425 AGCTGAGCCTTGAAGGACAGTGG + Intronic
1122658961 14:103281709-103281731 GGCTGTGTGGGGAAGTGCAGGGG + Intergenic
1125087171 15:35743846-35743868 AGCTGTGGCCTGAAGTACACAGG - Intergenic
1125830912 15:42716594-42716616 AGCTGTGAGATGCAGTTCAGAGG + Intronic
1127234942 15:57038840-57038862 AGCGTTGTATTGAAGTGCAGTGG + Intronic
1128713255 15:69887820-69887842 AGCTGTATCTAGAACTACAGTGG + Intergenic
1129030442 15:72614129-72614151 CGCTGTGTGTTGCAGCAGAGTGG - Intergenic
1129209783 15:74061157-74061179 CGCTGTGTGTTGCAGCAGAGTGG + Intergenic
1129306894 15:74671904-74671926 GGCTGTGTGCTTAAGGACAGGGG + Intronic
1129404243 15:75304242-75304264 CGCTGTGTGTTGCAGCAGAGTGG - Intergenic
1129568323 15:76649146-76649168 AGGAGTGAGTTTAAGTACAGAGG - Intronic
1130637109 15:85633408-85633430 AGTTTTGTATTGCAGTACAGTGG + Intronic
1133267360 16:4593207-4593229 AGCTGTCTGTTGGAGGACAAGGG - Exonic
1138752248 16:59437942-59437964 ATATGTGTGTTGAAGTATATAGG + Intergenic
1139107534 16:63845978-63846000 AGCTGGGTGGAGAAGTCCAGTGG + Intergenic
1141649041 16:85383209-85383231 ATGTGTGTGTTTATGTACAGAGG - Intergenic
1141852532 16:86657066-86657088 GGCTGTGTGCTGAAGCACAGTGG - Intergenic
1145750372 17:27351017-27351039 ACCTGTGTGGGCAAGTACAGAGG + Intergenic
1152089090 17:78237176-78237198 AGCTGTGGGCCGAAGCACAGAGG + Intronic
1152784990 17:82243069-82243091 AGCTGTGTGTTGAAGTACAGAGG - Exonic
1152794457 17:82300293-82300315 AGCGGTGTGTGGAACTTCAGGGG - Intergenic
1153278058 18:3388247-3388269 AGTTGTGTATAAAAGTACAGTGG + Intergenic
1153465339 18:5382020-5382042 AGCTGTTTCTTGAAGTACAATGG - Intergenic
1153798006 18:8642413-8642435 AGCTTTGTGGAGAATTACAGTGG + Intergenic
1158392971 18:57058605-57058627 AGCTGTGGGTTAAAGTGGAGTGG - Intergenic
1161945057 19:7430488-7430510 AGCTGTGTATTTGGGTACAGTGG - Intronic
1162720795 19:12661432-12661454 AGCTGTGTTTTGATGTATATGGG + Intronic
1163261169 19:16190881-16190903 AGGTGTCTGTTGAAGTCCTGGGG - Exonic
1165038702 19:33053706-33053728 AGCTGGGTGTCCAGGTACAGTGG - Intronic
1165848137 19:38832151-38832173 AGCTGTGTGATGAACTTTAGCGG - Intronic
1166839258 19:45686627-45686649 AGCCCTGTGTTGCAGTGCAGGGG - Intergenic
1167034983 19:46989772-46989794 AGCTGAGGTTTGAAGGACAGAGG + Intronic
924992969 2:329934-329956 AGCTGTATGTTGCAAGACAGGGG - Intergenic
929048319 2:37812644-37812666 AACTATGTGTTTAAGAACAGGGG - Intergenic
931761000 2:65416865-65416887 AGCTGTGTGATTCAGTACAGAGG + Intronic
940581142 2:155583029-155583051 AGTTTTATGTTGAAGAACAGTGG + Intergenic
945233851 2:207616437-207616459 AGATATGTGTGGAATTACAGGGG - Intronic
946124142 2:217545285-217545307 AGCTGTGTGATAAAGTTAAGTGG + Intronic
947907790 2:233778127-233778149 ATGTGTGTGCTGAAGTACAGGGG - Intronic
1170665582 20:18383136-18383158 AGCTGTCTGTGGGAGGACAGAGG - Intergenic
1171305878 20:24105331-24105353 AGCTGAGTGATGGAGTGCAGGGG + Intergenic
1171970725 20:31563307-31563329 ACCTGTGTGTTGGAGAGCAGGGG - Intronic
1175018794 20:55822249-55822271 AGCTGAGTTTTGAAGAACGGTGG + Intergenic
1176717714 21:10367513-10367535 AGCTGTCTGTTGTCTTACAGTGG + Intergenic
1180298941 22:11020433-11020455 AGCTGTCTGTTGTCTTACAGTGG + Intergenic
1180621392 22:17164896-17164918 AGCTGTGGCTGGAAGAACAGGGG + Intronic
1180883507 22:19223473-19223495 AGCTGGTCCTTGAAGTACAGTGG + Intronic
1181061217 22:20282978-20283000 AGCAGTGTTTTCAAGGACAGGGG - Intronic
1184522364 22:45002669-45002691 AGATGTGTGTAGGAGTGCAGGGG - Intronic
1184601134 22:45544029-45544051 AGCTGTGAGAGGAAGTACTGAGG + Intronic
949929220 3:9065107-9065129 AGCTGTTTCCTGAAGTACAATGG + Intronic
952007636 3:28860415-28860437 AGTTGTGGGATGGAGTACAGCGG + Intergenic
954700463 3:52448076-52448098 AGGAGTGAGCTGAAGTACAGGGG - Intergenic
956766763 3:72490854-72490876 AGCTGGGTGATGAAGTCAAGAGG - Intergenic
959004324 3:101002944-101002966 AGTACTGTGTTGAAGAACAGTGG + Intergenic
959261569 3:104088749-104088771 TGCTGTGTATTGAAATATAGGGG + Intergenic
960533003 3:118786471-118786493 AACTATGTATCGAAGTACAGAGG + Intergenic
963994885 3:151696568-151696590 AGCTGTTTGTTGATGATCAGTGG - Intergenic
965227183 3:166004939-166004961 AGATGTCTGCTAAAGTACAGAGG - Intergenic
965454481 3:168880874-168880896 AGCTTTGAGTTGAAATATAGAGG - Intergenic
970835300 4:20397783-20397805 AGCCGTGTGTGGGAGGACAGTGG - Intronic
971036278 4:22696367-22696389 AACTGTATTTTGAAATACAGTGG - Intergenic
971877971 4:32328636-32328658 AGCTGTCTGTCGAAAGACAGAGG - Intergenic
974277367 4:59740413-59740435 AGATGTGTGTTGATGTGAAGAGG - Intergenic
975610165 4:76195479-76195501 TGTTGTGTTTTGAAGTGCAGCGG - Intronic
976326591 4:83778847-83778869 ATCGCTGTGTTGTAGTACAGGGG + Intergenic
977525731 4:98143348-98143370 AGCTCTGTGGTAAAGTAGAGGGG + Intergenic
978301166 4:107270617-107270639 AGCAGTGTGTTCAGGCACAGAGG - Intronic
979824738 4:125218869-125218891 AGCTTTGTCTTGAAGGACAATGG + Intergenic
979946261 4:126835298-126835320 AGCACTGTGTTGAATAACAGTGG - Intergenic
980795844 4:137681526-137681548 GGCTGTTTGTTGAAGGAAAGGGG - Intergenic
982890918 4:160849006-160849028 AGCTGAGTGCTGAAGGACACTGG - Intergenic
984619549 4:181936969-181936991 AGCAGTGTGTTGTTGTAAAGAGG + Intergenic
984799912 4:183705210-183705232 AGGAGTGTGTAGAAGTAGAGAGG - Intronic
985572585 5:657320-657342 AGCTGCGTGCTCTAGTACAGTGG + Intronic
985653988 5:1120499-1120521 AGTTGTGTGGGGAGGTACAGCGG - Intergenic
986526997 5:8689420-8689442 AGCTCTGTGCTGAATTTCAGTGG - Intergenic
989074494 5:37549664-37549686 AGCACTGTGTTGAATAACAGTGG + Intronic
989967076 5:50477032-50477054 AGCTGTGTCTTGTTGTAAAGTGG + Intergenic
990024714 5:51172316-51172338 AGCTGTGTGTTGCACAAAAGTGG - Intergenic
991557730 5:67914405-67914427 CTCTGTGTGTTGAAGTAGAAGGG + Intergenic
998831584 5:146165291-146165313 ACCTGGGCTTTGAAGTACAGTGG - Intronic
1001730873 5:173955941-173955963 AGCTGTGTGATGAATGTCAGGGG + Exonic
1005778581 6:29164099-29164121 AGCTTTGTGTTGAAATTCATAGG - Intergenic
1012813818 6:103996303-103996325 AGTAGTGTCTTGAAGTACAGAGG + Intergenic
1016241202 6:141933460-141933482 AGATGTGTGATGAAGTTCGGTGG - Intergenic
1017460459 6:154644789-154644811 AGTTGTGTGCTGGAGTGCAGTGG + Intergenic
1018026999 6:159814417-159814439 AGCTGGGAGTTGAAGCCCAGGGG - Intronic
1018862486 6:167721048-167721070 GGCTGTGTGCTGAATTTCAGGGG - Intergenic
1020680304 7:11228574-11228596 AGCTGTGTTTCAAAGGACAGTGG + Intergenic
1023765714 7:43508676-43508698 AGCTGTGTGTTTTAGCTCAGAGG + Intronic
1025974143 7:66356368-66356390 TGCTGGGTGTGGAAGTTCAGTGG - Intronic
1028034193 7:85959127-85959149 AGGTGTCTTTTGAAGTACAACGG + Intergenic
1030440634 7:109584196-109584218 AGCTGTGTGCTGAAGCCCTGGGG - Intergenic
1030970226 7:116046733-116046755 AGTTTTGTGGTGAAGTACAGTGG - Intronic
1030987419 7:116258692-116258714 AGCTATGTGTAGAAGTACACAGG - Exonic
1031538751 7:122966997-122967019 AGCTCTGTTCTGAAGTACATTGG + Intergenic
1032166560 7:129549860-129549882 GTCTGTGTGTGGATGTACAGTGG - Intergenic
1033049076 7:137987958-137987980 AGCTGTGTGGTGAATTAAATGGG - Intronic
1035813647 8:2515004-2515026 AGCTGTGTGTGGATGGGCAGTGG + Intergenic
1037599105 8:20378809-20378831 AGCTCTGTTTTGAACTCCAGGGG - Intergenic
1037824175 8:22151182-22151204 AGCTGAGTCTTGAAGAATAGAGG - Intronic
1038205728 8:25463139-25463161 TACTGTGTGTTGATGTATAGGGG + Intronic
1039567841 8:38564107-38564129 AGCTGTGGACTGAGGTACAGAGG - Intergenic
1039645708 8:39280076-39280098 AGTTGTGTTCTGAAGTGCAGTGG + Intronic
1042152020 8:65798027-65798049 CACTGTGTTTTGAAGAACAGAGG - Intronic
1042279709 8:67042392-67042414 AGCAGTGTGTAGAAGCTCAGAGG - Intronic
1042791081 8:72607052-72607074 TACTGTGTGTTGATGTAGAGAGG + Intronic
1043318389 8:78949896-78949918 AGCTGTATGCTGAATAACAGTGG - Intergenic
1044690667 8:94874439-94874461 AGCTGTGTGTGGAGGAACGGGGG - Intronic
1046119747 8:109830972-109830994 ACCTGTGTGATGAGTTACAGTGG - Intergenic
1047201975 8:122775004-122775026 ATCTGTGTCTTGAAGGACCGAGG + Intergenic
1048483295 8:134822457-134822479 AGCTGTGAGTTGAAGATGAGGGG - Intergenic
1048712493 8:137227667-137227689 AACTGTCTATTGCAGTACAGTGG - Intergenic
1049607123 8:143534884-143534906 AGCCGGGTGTTGCAGCACAGTGG - Intronic
1051526683 9:18052770-18052792 AGCTGTGTTTTGTACTAGAGTGG + Intergenic
1053005810 9:34603706-34603728 AGCTGTTTGTTGAATAACTGAGG + Intergenic
1053161738 9:35818275-35818297 AGCTGCCTGTTGAAGGAAAGTGG - Exonic
1056003795 9:82245481-82245503 AGCACTGTGTTGAATAACAGTGG + Intergenic
1056167832 9:83956223-83956245 AAGTGTGTGGTGAGGTACAGAGG - Exonic
1056752495 9:89362684-89362706 CTGTGTGTGCTGAAGTACAGAGG + Intronic
1058802469 9:108558065-108558087 AGCTGGGTATTGAGGGACAGGGG - Intergenic
1060763060 9:126272333-126272355 ACCAGTGTTTTGAAGTACAAAGG - Intergenic
1060957429 9:127652669-127652691 AGCTTTCTGCTGCAGTACAGGGG - Intronic
1062032753 9:134369374-134369396 GGTTGTGTGTGGGAGTACAGGGG + Intronic
1062206206 9:135338838-135338860 AGCTGTGCGTGGAAGTCCTGGGG + Intergenic
1203769481 EBV:41553-41575 GTCTGTGTGTTGAAGGGCAGGGG + Intergenic
1185542760 X:916687-916709 AGCTGTCTGTTGTCTTACAGCGG - Intergenic
1188091288 X:25968349-25968371 AGCAGTGTGTTGCAGAGCAGTGG - Intergenic
1188387262 X:29576258-29576280 AGCTGTGTATTCAAGTACCATGG - Intronic
1188682576 X:33029120-33029142 AGCAGTATGATGAAGTGCAGGGG - Intronic
1189844757 X:45124605-45124627 AGTAATGTGTTGAATTACAGTGG + Intergenic
1192507707 X:71699085-71699107 AACTGTGTGTGGAAGTGCGGAGG - Intergenic
1192518989 X:71782467-71782489 AACTGTGTGTGGAAGTGCGGAGG + Intergenic
1198063337 X:133069959-133069981 AGATGGAAGTTGAAGTACAGTGG + Intronic
1198640367 X:138749521-138749543 AGCTGAGTTTTGAAGGCCAGTGG + Intronic
1198884021 X:141313880-141313902 AGCAATGTGTTAAAGCACAGAGG - Intergenic
1201283444 Y:12360133-12360155 AGCTGGGTGTGGAAGCACTGGGG + Intergenic