ID: 1152785195

View in Genome Browser
Species Human (GRCh38)
Location 17:82244134-82244156
Sequence ACGGGCACACACACACACCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2411
Summary {0: 1, 1: 1, 2: 12, 3: 456, 4: 1941}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152785189_1152785195 8 Left 1152785189 17:82244103-82244125 CCAAAATCAGGTTGAAGAGGTCC 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1152785195 17:82244134-82244156 ACGGGCACACACACACACCACGG 0: 1
1: 1
2: 12
3: 456
4: 1941

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152785195 Original CRISPR ACGGGCACACACACACACCA CGG Exonic
Too many off-targets to display for this crispr