ID: 1152789406

View in Genome Browser
Species Human (GRCh38)
Location 17:82270800-82270822
Sequence TCCCAGACAGCCACCCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152789406_1152789414 5 Left 1152789406 17:82270800-82270822 CCCTGATGGGTGGCTGTCTGGGA 0: 1
1: 0
2: 0
3: 21
4: 158
Right 1152789414 17:82270828-82270850 GTCTGGGGGCTCCAACCCCAGGG 0: 1
1: 0
2: 6
3: 48
4: 357
1152789406_1152789413 4 Left 1152789406 17:82270800-82270822 CCCTGATGGGTGGCTGTCTGGGA 0: 1
1: 0
2: 0
3: 21
4: 158
Right 1152789413 17:82270827-82270849 TGTCTGGGGGCTCCAACCCCAGG 0: 1
1: 0
2: 1
3: 20
4: 283
1152789406_1152789412 -9 Left 1152789406 17:82270800-82270822 CCCTGATGGGTGGCTGTCTGGGA 0: 1
1: 0
2: 0
3: 21
4: 158
Right 1152789412 17:82270814-82270836 TGTCTGGGACGGCTGTCTGGGGG 0: 1
1: 0
2: 1
3: 19
4: 258
1152789406_1152789411 -10 Left 1152789406 17:82270800-82270822 CCCTGATGGGTGGCTGTCTGGGA 0: 1
1: 0
2: 0
3: 21
4: 158
Right 1152789411 17:82270813-82270835 CTGTCTGGGACGGCTGTCTGGGG 0: 1
1: 0
2: 3
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152789406 Original CRISPR TCCCAGACAGCCACCCATCA GGG (reversed) Intronic
900207263 1:1436865-1436887 CCCCAGACAGCCCCACAGCAAGG - Intronic
900387712 1:2418117-2418139 TGCGAGGCAGACACCCATCACGG + Intergenic
901535072 1:9877238-9877260 TCCCAGACAGAGACCCATACAGG - Intronic
901574183 1:10186690-10186712 TCCCAAACCGCATCCCATCAGGG + Intergenic
901860635 1:12072320-12072342 TCCCACACTGCCCCCCATCGAGG - Intronic
903127433 1:21257484-21257506 TCCCAGCCTGCCTCCCAGCACGG - Intronic
904001750 1:27342783-27342805 ACCCACACAGCCACACAACAGGG + Intronic
905629556 1:39511072-39511094 CCCCAGACACCCACCACTCAAGG - Intronic
906249179 1:44298115-44298137 TCCCAGACATCCTGCCTTCATGG - Intronic
906521192 1:46467956-46467978 CCACAGACAGGCACTCATCATGG + Intergenic
907529457 1:55079312-55079334 GCCCAGCCAGCTACCCATCAGGG - Intronic
912689873 1:111796801-111796823 TCCCAGAGAACCTCCCAGCAGGG - Intronic
912964809 1:114228225-114228247 TCCCAGACAGCGAGCCATACAGG + Intergenic
914714437 1:150242526-150242548 TCCCAGAAAACCACCCAACAGGG + Intergenic
916075650 1:161198602-161198624 TCCCAGACAGGCTCGCATCCCGG - Exonic
916336854 1:163681920-163681942 TCACAGACAGCTACCCATTTTGG + Intergenic
918440129 1:184558650-184558672 TCCCAGATGGCCAACAATCAAGG - Intronic
918652834 1:186987103-186987125 TCCCAGACACCCAACAAGCAAGG - Intronic
918990494 1:191692669-191692691 TCAGAGACAGCCAGCCTTCAGGG + Intergenic
919361008 1:196594749-196594771 TACCAGACAGCCTCAGATCATGG + Intronic
919911402 1:202113187-202113209 TCCCAGACAGCCACCTAAACAGG + Intergenic
923658001 1:235935060-235935082 ACACACACAGACACCCATCAGGG - Intergenic
1063703425 10:8407938-8407960 TCACAGGCACCCTCCCATCATGG - Intergenic
1069746307 10:70717147-70717169 TCACAGACAGACTCCCATCGTGG + Intronic
1071569800 10:86690676-86690698 TCCCAGCCAGCCAGCCCTCTGGG + Intronic
1072616140 10:97049882-97049904 TCGCACACAGCAACCCATCACGG - Intronic
1075787060 10:125057126-125057148 TCCCAGAGAGGCACCCAGGAAGG + Intronic
1077716064 11:4581814-4581836 TACCAGGCATCAACCCATCAGGG + Intergenic
1081684483 11:45032562-45032584 TCCCTGAGAGCCACCTATCCTGG + Intergenic
1083040576 11:59681560-59681582 CCCCAGCCCGCCACCCATAAAGG + Intergenic
1083334160 11:61913156-61913178 TCCCTGACAGCCCCTCATCCAGG - Intronic
1084470661 11:69357223-69357245 TCCCAGGCAGCCACACAGCAGGG - Intronic
1084559555 11:69895251-69895273 ACCCAGACACCCACCCAGCCGGG + Intergenic
1086027752 11:82314993-82315015 TGGAAGACAGCCACCCATAATGG + Intergenic
1089526142 11:119098031-119098053 CCCCACACAGGTACCCATCACGG - Exonic
1089647919 11:119892312-119892334 CCCCACACACCCACCCACCATGG + Intergenic
1093625024 12:21335723-21335745 TCCCAAACACACACACATCAAGG + Intronic
1094114575 12:26896617-26896639 GCCCTGAAAGCCACCCATCCTGG + Intergenic
1095184920 12:39190395-39190417 TCGAACACAGCCACCCATCTGGG - Intergenic
1096580037 12:52579209-52579231 TCCCAGACAGGCAGTCAGCATGG + Intergenic
1097415202 12:59306615-59306637 GCCCAGAAGGCCACCAATCAAGG + Intergenic
1101066577 12:101027774-101027796 GCCCAGAATGCCACCCAGCAAGG + Intronic
1101912777 12:108872950-108872972 TGCCAGACTGCCATCCAGCAGGG - Intronic
1104356648 12:128092677-128092699 TCCCACACAGCCTCCAATCTGGG + Intergenic
1104683467 12:130768500-130768522 CCCCTGCAAGCCACCCATCAGGG - Intergenic
1105711061 13:23009503-23009525 TCAAATACAGCCACCCATCTGGG + Intergenic
1112088859 13:96060540-96060562 TCCCAGACAGCCACCACGCCCGG - Intergenic
1112239349 13:97665617-97665639 TCCCTGACATCCACCTCTCAGGG - Intergenic
1121671300 14:95712479-95712501 TGCCAGCCATCCACCCATCTGGG + Intronic
1122654778 14:103250708-103250730 TCTCAGACTGCTACACATCATGG + Intergenic
1123684836 15:22789459-22789481 TCCCTGTGAGCCACCCATCAAGG + Intronic
1125346495 15:38723866-38723888 TCCCAGCCAACCACCCATCCAGG - Intergenic
1131608040 15:93930040-93930062 TCCCAGAAAGCTACCCCTGAGGG + Intergenic
1133455326 16:5936837-5936859 CCCCAGAAAGCCAGCCATCTGGG + Intergenic
1135344668 16:21678813-21678835 CCCCAGAAAGCCACTCATGAAGG - Intronic
1137070681 16:35901932-35901954 TCTAAGCCAGCCACCCATCCAGG + Intergenic
1137247450 16:46717355-46717377 CCCCAAACAGCCACTCAGCATGG + Intronic
1138257024 16:55574330-55574352 TCCCAGAGGGGCTCCCATCATGG + Intronic
1138370547 16:56523303-56523325 TCCCTGCCAAGCACCCATCAGGG + Intergenic
1141768693 16:86075394-86075416 GGCCAGACAGCCACCCACTAAGG - Intergenic
1142251954 16:88996109-88996131 TCTCAGACAGCCACTCATTCCGG - Intergenic
1142687598 17:1586709-1586731 TCCCAGAAAGGCACCGCTCACGG + Intronic
1147953679 17:44120919-44120941 TCCAAGTCAGCCACCCTTCATGG - Intronic
1151633319 17:75326221-75326243 TCCCAGAAAGCGACTCACCAAGG + Intronic
1152198782 17:78933308-78933330 CCGCAGACAGGCACCCCTCAGGG + Intergenic
1152541701 17:80979900-80979922 TCCCACACAGCCAGCCTTCCAGG - Intergenic
1152789406 17:82270800-82270822 TCCCAGACAGCCACCCATCAGGG - Intronic
1153488425 18:5625382-5625404 TCCCTGACAGACACACACCACGG - Intronic
1153971399 18:10230266-10230288 TCCCAGACAGCTCCCTCTCATGG - Intergenic
1155008101 18:21747773-21747795 TCCCAGGTAGCCACCCACCAGGG + Intronic
1156378720 18:36537514-36537536 TCTCTGACACCCACCCAGCAAGG - Intronic
1157559358 18:48635825-48635847 TCCCAGCCAGTCACCCAGCATGG + Intronic
1161028020 19:2045621-2045643 TCCCAGGCAGCCAGCCCTCCTGG + Intronic
1161265492 19:3361586-3361608 TCCCAAACAGCCCCCCATGATGG - Intronic
1162958184 19:14111509-14111531 GCCCAGCCAGGCACCCATCTAGG - Intronic
1163593241 19:18205711-18205733 TCCGAGAGAGCCACCCATGTAGG - Intergenic
1164330611 19:24251150-24251172 TCTCAGACAGCCAGACATAATGG - Intergenic
1164539708 19:29113748-29113770 CCCCAGACAGCCAGGTATCACGG + Intergenic
1165070135 19:33251053-33251075 TCGCAGTCAGCCACCCTGCAAGG + Intergenic
1165322877 19:35097002-35097024 TCCCAGGCAGCCACCCACCCAGG - Intergenic
926751763 2:16203915-16203937 TCCCAGATAGTCAAGCATCAGGG + Intergenic
926934206 2:18070961-18070983 TCCCAGCCAGCCAGCCTGCATGG + Intronic
927004017 2:18828600-18828622 TCCCTCACAACCAACCATCAGGG - Intergenic
927114621 2:19888232-19888254 TGCCAGACAGACAACCAACATGG + Intergenic
927913262 2:26916374-26916396 CCCCCGACAGCCTCCCATCCTGG + Intronic
928096559 2:28408571-28408593 TCCCAGGCAGCCAGACATCAGGG + Intronic
929891697 2:45923778-45923800 TCCTAGAAAGCCACCCTCCAAGG - Intronic
931720068 2:65061234-65061256 TACCAGACAGCCTCCCAGCAAGG - Intronic
931899766 2:66774705-66774727 TCACAGTGAGGCACCCATCATGG + Intergenic
934489015 2:94745206-94745228 CCCCAGCCAGACACCCATAAAGG - Intergenic
934962979 2:98694084-98694106 CCCCAGCCACCCACCCACCATGG + Intronic
935282342 2:101528940-101528962 GGACAGACAGCCACTCATCAGGG - Intergenic
935424578 2:102906739-102906761 TCCCACTCAGCCACTCTTCATGG + Intergenic
937322202 2:120967490-120967512 TTCCAGACTGCTCCCCATCACGG - Intronic
938711087 2:133976887-133976909 TCCCAGACACTCACCCAGCCTGG - Intergenic
941724392 2:168845359-168845381 TTCCAGGCACCCACCCTTCAAGG + Intronic
944862509 2:203828485-203828507 TCCAAGGCAGACAGCCATCAAGG - Intergenic
946308206 2:218868148-218868170 TCCCAGGCAGCCAGCCAGCCTGG + Intronic
1169530613 20:6481232-6481254 CCCCAGACAGCCTCCCATGATGG - Intergenic
1170628146 20:18045051-18045073 TCCAGGACAGCCACCCAACTGGG - Intronic
1171229548 20:23472539-23472561 TCGAACACAGCCACCCATCTGGG + Intergenic
1175518870 20:59587061-59587083 TCCAAGACAGGCACCCCACAAGG - Intronic
1176250443 20:64117853-64117875 GCCCAGACACCCCCCCATCACGG - Intergenic
1182120164 22:27781365-27781387 TCCCTGGCCTCCACCCATCAGGG + Intronic
1183107063 22:35622417-35622439 TCCCAGGAACCCACCCACCAGGG + Intronic
1183588733 22:38767941-38767963 TCCCAGAGAGGCACCCAGCATGG + Intronic
1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG + Intergenic
950541602 3:13616502-13616524 GACCAGACCGCCAGCCATCATGG + Intronic
952460986 3:33525875-33525897 TTCCAGACAGCCACCGTTAACGG + Intronic
953906459 3:46870727-46870749 CTCCAGACAGACACACATCAGGG - Intronic
957769331 3:84669035-84669057 TCCCAAACAGCCACCCAATTAGG - Intergenic
961119870 3:124364749-124364771 CACCAGACAGCCACTCATTAGGG + Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
965559148 3:170045136-170045158 TTCCTGAAAGCCACCCAACAAGG - Intronic
965777228 3:172243886-172243908 TCTCAGACTGTCACCTATCATGG - Intronic
966768756 3:183485389-183485411 TCCCAGACAGCAACTCAAAAGGG - Intergenic
968034921 3:195540168-195540190 TCACAGACAGCCACAGAGCAGGG + Intronic
968231209 3:197005775-197005797 CCCCAGACAGGCTCCCACCAGGG - Intronic
969444353 4:7235587-7235609 TCCCAGGAAGCCACCCCTCAGGG - Intronic
969696200 4:8736278-8736300 TCCCAGATAGCCACACATTAAGG - Intergenic
970440960 4:16080910-16080932 CCGCAGCCACCCACCCATCAGGG + Intronic
970529978 4:16971703-16971725 TCCCACACAGCCACCAAACAAGG - Intergenic
972024799 4:34363136-34363158 TCCCTGTGAGCCACCAATCAGGG + Intergenic
976852103 4:89559415-89559437 AACCTAACAGCCACCCATCATGG + Intergenic
976977447 4:91182093-91182115 TCGAACACAGCCACCCATCTGGG - Intronic
979942528 4:126779730-126779752 CCCCAGACAGCCAGGCTTCAGGG + Intergenic
980637058 4:135519874-135519896 TTCCACACAGCTTCCCATCAAGG - Intergenic
980909139 4:138978136-138978158 TTCCAGACCCCCACCCATCCAGG + Intergenic
981147227 4:141339444-141339466 TCTCAGGAAGCCAACCATCAGGG + Intergenic
984767150 4:183408340-183408362 CCCCAGACAGCCATGCATCCAGG + Intergenic
984927863 4:184822338-184822360 TCCAAGCCAGCCACACTTCAAGG + Intronic
989372328 5:40722789-40722811 GCCCAGCCAGCCGCCCATCCGGG + Intronic
990306596 5:54499656-54499678 TCGAACACAGCCACCCATCTGGG - Intergenic
991174741 5:63674076-63674098 TTCCAGAAAGCCATCCATAATGG - Intergenic
992499466 5:77327690-77327712 TCCCAGTCAGCCACCCCACAGGG - Intronic
993406323 5:87515834-87515856 TCCAACACAGCCACCCACCTGGG + Intergenic
998300648 5:141016402-141016424 TCCAAGACAGCCAAAAATCAAGG + Intergenic
1002878540 6:1232606-1232628 TCCCAGAAAGAACCCCATCAAGG + Intergenic
1002935804 6:1671350-1671372 TCCCAGAGAGCACCCCAGCAGGG - Intronic
1007257477 6:40538990-40539012 GCCCAGACTTCCACCCATGAGGG - Intronic
1010711997 6:79185799-79185821 TGCCAGACAGACACCCTGCAAGG - Intergenic
1012159876 6:95871200-95871222 TCCCTGAAAGTCAACCATCAAGG + Intergenic
1018468125 6:164071033-164071055 GCCCAGAGAGCCACTCATAAGGG - Intergenic
1019998191 7:4738678-4738700 TCCCAGACAGCTTCTCATCTTGG + Intronic
1023967979 7:44973137-44973159 TCCCAGACAGCCCTACTTCATGG + Intronic
1025944497 7:66095454-66095476 TCCCAGTCACCCTCCCCTCAAGG - Intronic
1026890474 7:73978896-73978918 TCCCAAACAGCCGCCTACCACGG - Intergenic
1033132357 7:138755579-138755601 TTCCAGCCAGCCTCCCAGCAAGG + Intronic
1034541730 7:151762859-151762881 TCCCAGCCAGCCATCAGTCAGGG - Intronic
1036450595 8:8863859-8863881 TCTCAGAAAACCAACCATCAGGG + Intronic
1038687545 8:29732284-29732306 TCCCAGACAGCAAGCAAGCAAGG + Intergenic
1042343332 8:67703278-67703300 CCCCAACAAGCCACCCATCAGGG - Intronic
1045124921 8:99078914-99078936 GCCTAGACAGACACCCACCATGG - Intronic
1049540716 8:143207622-143207644 TCCCAGGCAGCCACACTCCAGGG - Intergenic
1049640504 8:143713029-143713051 TCCCTGAGAGGCAGCCATCAGGG + Intronic
1053458382 9:38249604-38249626 TCTCAGAGAGCCTCCAATCAAGG + Intergenic
1053668772 9:40339143-40339165 CCCCAGCCAGACACCCATAAAGG + Intergenic
1053918571 9:42965416-42965438 CCCCAGCCAGACACCCATAAAGG + Intergenic
1054379908 9:64479180-64479202 CCCCAGCCAGACACCCATAAAGG + Intergenic
1054515839 9:66037151-66037173 CCCCAGCCAGACACCCATAAAGG - Intergenic
1055710562 9:79056432-79056454 ACCCAGAAAGACACCCAGCAAGG - Intergenic
1056487871 9:87077020-87077042 TCCAAGACAGACACCTTTCAGGG + Intergenic
1056776305 9:89515657-89515679 TCCCTGGCAGCCTCCCACCAAGG - Intergenic
1057258314 9:93568531-93568553 TCCCAGATAGCCTCCACTCATGG - Intergenic
1057426220 9:94951905-94951927 TCCCAGAACCCCACCCAGCATGG + Intronic
1057847862 9:98539239-98539261 TCACAGACAGCCACCCTGTAAGG - Intronic
1058615007 9:106816844-106816866 TCCTAGACAGCCATCCAGAATGG + Intergenic
1058941789 9:109820359-109820381 TCCCAGACAGACATACATGAGGG - Intronic
1062098520 9:134715468-134715490 CCCCAGACTGACACCCATGAAGG - Intronic
1185695748 X:2193136-2193158 TCCCCGAGCTCCACCCATCAGGG - Intergenic
1186776398 X:12868911-12868933 TCCCATTATGCCACCCATCAAGG - Intronic
1189919962 X:45893862-45893884 TCATATACAGCCACCAATCAAGG - Intergenic
1190165578 X:48070861-48070883 TCTGAAAAAGCCACCCATCATGG + Intronic
1190705020 X:53020407-53020429 TTCCTGAGAGCCACCCAGCATGG + Intergenic
1191826393 X:65369950-65369972 GCCCAGACAGCCACCAAGCCTGG - Intronic
1192547792 X:72027937-72027959 TCCTAAACTCCCACCCATCATGG - Intergenic
1192631221 X:72779335-72779357 TCCCAGACATCCACCACCCAGGG - Intronic
1192650488 X:72941466-72941488 TCCCAGACATCCACCACCCAGGG + Intronic
1193732287 X:85115897-85115919 CCCCTGAAAGCCACACATCAGGG + Intergenic
1194033811 X:88846603-88846625 TCCCAGACAGCCACAAAAAAAGG - Intergenic