ID: 1152789915

View in Genome Browser
Species Human (GRCh38)
Location 17:82273370-82273392
Sequence TCTCAGCTCCATGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 302}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152789906_1152789915 0 Left 1152789906 17:82273347-82273369 CCCAGCCGGTACCTGTTCCCGAC 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1152789915 17:82273370-82273392 TCTCAGCTCCATGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 16
4: 302
1152789902_1152789915 18 Left 1152789902 17:82273329-82273351 CCGCTGCCGATCTTCCGGCCCAG 0: 1
1: 0
2: 1
3: 3
4: 86
Right 1152789915 17:82273370-82273392 TCTCAGCTCCATGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 16
4: 302
1152789907_1152789915 -1 Left 1152789907 17:82273348-82273370 CCAGCCGGTACCTGTTCCCGACT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1152789915 17:82273370-82273392 TCTCAGCTCCATGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 16
4: 302
1152789905_1152789915 4 Complete closest: 810
total_pairs: 2
max_distance: 1000
Left 1152789905 17:82273343-82273365 CCGGCCCAGCCGGTACCTGTTCC 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1152789915 17:82273370-82273392 TCTCAGCTCCATGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 16
4: 302
1152789908_1152789915 -5 Left 1152789908 17:82273352-82273374 CCGGTACCTGTTCCCGACTCTCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1152789915 17:82273370-82273392 TCTCAGCTCCATGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 16
4: 302
1152789904_1152789915 12 Complete closest: 810
total_pairs: 2
max_distance: 1000
Left 1152789904 17:82273335-82273357 CCGATCTTCCGGCCCAGCCGGTA 0: 1
1: 0
2: 1
3: 1
4: 40
Right 1152789915 17:82273370-82273392 TCTCAGCTCCATGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 16
4: 302
1152789900_1152789915 27 Left 1152789900 17:82273320-82273342 CCGAAGGAGCCGCTGCCGATCTT 0: 1
1: 0
2: 2
3: 3
4: 64
Right 1152789915 17:82273370-82273392 TCTCAGCTCCATGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 16
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152789915 Original CRISPR TCTCAGCTCCATGGCGGCGG CGG Exonic
900164466 1:1239253-1239275 TCCCAGCTGCAGGGCGGCAGGGG + Intergenic
901227734 1:7624119-7624141 TCTCAGCTTCAAGGCAGCCGTGG + Intronic
901679695 1:10906007-10906029 ACTCAGCTCCGTGGAGGCTGGGG + Intergenic
902829229 1:18999153-18999175 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
903826054 1:26146483-26146505 TCCCAGCTACATGGGGGCTGAGG - Intergenic
904203754 1:28839025-28839047 TCTCAGCTCCTGGGAGGCTGAGG - Intronic
904560793 1:31395901-31395923 TCCCAGCTACATGGAGGCTGAGG - Intergenic
905248101 1:36628687-36628709 TCTCAGCTCGATGGCAGCCACGG + Intergenic
906625217 1:47319558-47319580 TCTCAGCTACTTGGAGGCTGAGG - Intergenic
907097611 1:51795994-51796016 TCTCAGCTACTTGGGGGCTGAGG - Intronic
907567282 1:55447108-55447130 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
912502275 1:110130340-110130362 CCGCAGCTCCCTGGGGGCGGGGG + Intergenic
912820626 1:112865053-112865075 TCCCAGCTCCTTGGGGGCTGAGG - Intergenic
913249442 1:116900310-116900332 TCCCAGCTACATGGGGGCTGAGG - Intergenic
913998815 1:143675112-143675134 TCTCAGCTACTTGGGGGCTGAGG - Intergenic
914429794 1:147611061-147611083 TCTCAGGGCCTTGGGGGCGGGGG - Intronic
914509446 1:148318160-148318182 TCTCAGCTACTTGGGGGCTGAGG - Intergenic
915087725 1:153399435-153399457 TCTCAGCTCCAGGGCTTGGGTGG + Intergenic
916070710 1:161168106-161168128 CCTCAGGTCCAAGGCGGCGCTGG - Exonic
918046647 1:180945505-180945527 CCTCAGCCCCATGGCTGGGGCGG + Exonic
919970201 1:202571568-202571590 TCCCAGCTCCTTGGAGGCTGAGG - Intronic
920061759 1:203231576-203231598 CCTCAGCTCCTTGGTGGTGGGGG + Intronic
921749776 1:218778765-218778787 TATCAGCTTTATGGCAGCGGAGG - Intergenic
1063395693 10:5685138-5685160 TCTCAGGTCCTCGGGGGCGGCGG + Exonic
1064047006 10:12025908-12025930 TCTCAGCTACTTGGGGGCTGAGG - Intronic
1064440316 10:15347717-15347739 TCTCAGCTACTTGGAGGCTGAGG + Intronic
1064964705 10:21003273-21003295 TGTCAGCTGCATGGCGTGGGAGG - Intronic
1066174312 10:32887773-32887795 TCTCAGCTGCATGGCAGGTGTGG + Intergenic
1066362848 10:34747983-34748005 TCTCTGCTCCATGGCTGCCTGGG - Intronic
1067155679 10:43779520-43779542 ACTCAGCTCCATGGCCTCAGTGG + Intergenic
1069043327 10:63717584-63717606 TCCCAGCTACTTGGGGGCGGGGG - Intergenic
1070008440 10:72449047-72449069 TCCCAGCTCCCTGGAGGCTGAGG - Intronic
1072190528 10:93073612-93073634 GCTGAGCTCCGAGGCGGCGGTGG - Intronic
1072645356 10:97250498-97250520 TCTCAGCTACTTGGAGGCTGAGG - Intronic
1074006363 10:109428719-109428741 TCACAGCTCCCTGGTGGCAGAGG + Intergenic
1074712480 10:116188782-116188804 TCCCAGCTACATGGAGGCTGAGG + Intronic
1075696166 10:124437139-124437161 TCTCAGCTACTTGGAGGCTGAGG - Intergenic
1077860298 11:6171931-6171953 TCCCAGCTACTTGGAGGCGGAGG + Intergenic
1082026903 11:47579082-47579104 TCTGAGTAACATGGCGGCGGCGG + Exonic
1083613682 11:64016168-64016190 TGTCAGCTGCATGGTGGCGAGGG - Intronic
1083698619 11:64459054-64459076 TCTCAGCCCCATGGAGAAGGGGG + Intergenic
1083721075 11:64603810-64603832 TGTCATCCCCATGGCGGTGGAGG + Intergenic
1084004865 11:66317273-66317295 TCTCAGCCCCATGGGGCCTGGGG - Intergenic
1084192779 11:67506321-67506343 TCTCAGCGCCACGGCTGGGGCGG + Intergenic
1087664780 11:101031532-101031554 CCTCAGCTCCAAGGCTGTGGAGG + Exonic
1088056351 11:105584544-105584566 TCTCAGCTGCTTGGCTGAGGTGG - Intergenic
1088290831 11:108235178-108235200 TCTCAGCTACTTGGAGGCTGAGG + Intronic
1088712375 11:112520015-112520037 TCTCAGCTGCATGGCTGGGGAGG - Intergenic
1089018556 11:115187555-115187577 TCCCAGCTACTTGGGGGCGGGGG - Intronic
1089166211 11:116478480-116478502 TCTCAGCTCCCTTGCAGCTGCGG - Intergenic
1089289052 11:117426824-117426846 TCTCAGCTCCTAGGGAGCGGTGG + Intergenic
1091163766 11:133451724-133451746 TCTCAGCTACTTGGAGGCTGAGG + Intronic
1091654932 12:2338487-2338509 TATCAGCTTCATGGGGGTGGGGG - Intronic
1094704414 12:32900194-32900216 TCTCAGCTACTTGGCGATGGGGG - Intergenic
1095095507 12:38146161-38146183 TCCCAGCTCCTTGGAGGCTGAGG - Intergenic
1096160432 12:49372159-49372181 TCTCAGCTACTTGGAGGCTGAGG - Intronic
1096188511 12:49599531-49599553 GCCCAGCTCCATGGTGGTGGTGG + Exonic
1096336602 12:50761598-50761620 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1098648649 12:72938393-72938415 TTTCAGTTCCATGGCTGGGGAGG + Intergenic
1098686321 12:73425422-73425444 TCACAGCTCCATGGCTGGAGAGG + Intergenic
1102506072 12:113385206-113385228 TCTCAGCGGCATGGTGGTGGTGG + Exonic
1102886577 12:116526443-116526465 TCCCAGCTACATGGAGGCTGAGG + Intergenic
1103134601 12:118496927-118496949 TCCCAGCTACATGGAGGCTGAGG + Intergenic
1103334381 12:120178280-120178302 ACTCAGTTCCATGGGGGCAGGGG + Intronic
1103646203 12:122394767-122394789 TCCCAGCTCCCAGGAGGCGGAGG + Intronic
1103750749 12:123158745-123158767 TCTCAGCTACTTGGAGGCTGAGG - Intronic
1104038966 12:125117056-125117078 TCTCAGCTACTTGGAGGCTGAGG - Intronic
1104109975 12:125695614-125695636 TGTCAGCTCCATGAGGGCAGGGG + Intergenic
1104420211 12:128628598-128628620 TGTCAGCTCCATGTGGGCAGCGG + Intronic
1106512386 13:30422363-30422385 GCGCAGCTCCCTGGCCGCGGCGG + Intergenic
1107467844 13:40665933-40665955 GCCCGGCTCCGTGGCGGCGGCGG - Exonic
1110216626 13:73031267-73031289 TCTCAGCTCCTTGGAGGCTGAGG - Intergenic
1111772866 13:92621701-92621723 TCCCAGCTACATGGGGGCTGAGG + Intronic
1113525629 13:110972447-110972469 TCTCAGCTCCATGGTAGAGAGGG + Intergenic
1113699693 13:112375447-112375469 TCCCAGCTCCATGGTGGAGAGGG - Intergenic
1114779783 14:25525731-25525753 TCTCAGCTACTTGGGGGCTGAGG - Intergenic
1115829450 14:37318953-37318975 TCCCAGCTCCCTGGAGGCTGAGG - Intronic
1118445254 14:65844829-65844851 TCTCAGCATCATGGTGGGGGAGG + Intergenic
1118993670 14:70818622-70818644 TCTCAGCTACGTGGTGGCTGAGG - Intergenic
1119079223 14:71676175-71676197 TCTCAGCTACTTGGGGGCTGAGG + Intronic
1119821441 14:77619646-77619668 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1121112940 14:91324713-91324735 ACTCAGCTCCCTGGAGGCAGCGG + Intronic
1121279945 14:92690971-92690993 TCGCAGCTCCCTGGGGGCAGAGG - Intergenic
1121280080 14:92691804-92691826 TCACAGCTCCCTGGGGGCAGAGG + Intergenic
1122557156 14:102587196-102587218 TCTCAGCTACCTGGAGGCTGAGG - Intergenic
1123006466 14:105326223-105326245 TCTCAACTCCACTGCTGCGGGGG - Intronic
1123135256 14:106021959-106021981 GCTCAGCTCCATGGCTGCCTAGG - Intergenic
1123215430 14:106804929-106804951 TCTCAACTCCATCGTGACGGTGG - Intergenic
1124272500 15:28295513-28295535 TCCCAGCTCCTTGGGGGCTGAGG - Intronic
1125001833 15:34778853-34778875 TCTCAGCTACAAGGAGGCTGAGG - Intergenic
1125691556 15:41600194-41600216 TCCCAGCTCCTTGGAGGCTGAGG + Intergenic
1126026477 15:44450710-44450732 TCTCAGCTACTTGGAGGCTGAGG - Intronic
1126070559 15:44861838-44861860 AAAAAGCTCCATGGCGGCGGCGG - Intergenic
1126087458 15:45023274-45023296 AAAGAGCTCCATGGCGGCGGCGG + Exonic
1126902157 15:53325568-53325590 TGTCAGCTCCGTGGCAGCTGTGG - Intergenic
1128225345 15:65997645-65997667 TGTCAGCTCCATGAGGGCAGGGG + Intronic
1129603381 15:77012988-77013010 GCTGAGCTCCATGGAGGCAGAGG - Intronic
1129666460 15:77582152-77582174 ACTCACCCCCATGGCGGGGGCGG - Intergenic
1129976930 15:79830568-79830590 TTTCATCTCCATGGCGGTTGGGG + Intergenic
1130524825 15:84695513-84695535 TCCCAGCTCCTTGGAGGCTGAGG + Intronic
1131061570 15:89407788-89407810 TCCCAGCTCCACGGCGGCCGCGG + Intergenic
1131499744 15:92950635-92950657 TCTCAGCTACTTGGGGGCTGAGG + Intronic
1132157243 15:99504248-99504270 TCTCTGCTCTATGGTGGTGGGGG - Intergenic
1132191661 15:99867556-99867578 TCCCAGCTACATGGGGGCTGAGG - Intergenic
1132736355 16:1387987-1388009 TCTCAGCTCCATGACCCCTGTGG + Intronic
1132737871 16:1396056-1396078 TCTCAGCTACTTGGAGGCTGAGG - Intronic
1132831924 16:1932644-1932666 GCTCAGGTCCCTGGCGGCAGAGG + Intergenic
1132835622 16:1951495-1951517 TCTCAGCTACATGGGGGGTGAGG - Intronic
1133008646 16:2898135-2898157 TCTCAGCCCCAGGGAGGCTGTGG - Intronic
1133653282 16:7833571-7833593 TCCCAGCTACTTGGCGGCTGAGG + Intergenic
1134097395 16:11427558-11427580 TCCCAGCTACATGGAGGCTGGGG - Intronic
1134150946 16:11804472-11804494 TCCCAGCTACATGGAGGCTGAGG + Intergenic
1134749511 16:16614722-16614744 TCTCAGCTCCACGAGGGCAGGGG - Intergenic
1134995959 16:18738902-18738924 TCTCAGCTCCATGAGGGCAGGGG + Intergenic
1135612787 16:23883098-23883120 TATCAGCTCCATGGAGGGTGGGG - Intronic
1136141903 16:28293402-28293424 CCTCGGCTCCATGGCGACGCTGG - Intronic
1136957622 16:34803725-34803747 GCTCAGAGCCACGGCGGCGGGGG - Intergenic
1137278977 16:46958826-46958848 TCCCAGCTCCTTGGGGGCTGAGG + Intronic
1138555323 16:57767693-57767715 TCACAGCTCCATGGATGTGGTGG + Intronic
1138653147 16:58473279-58473301 TCTCAGCTACTTAGGGGCGGGGG - Intronic
1140237152 16:73170009-73170031 TGTAAGCTCCATGGAGGCAGGGG + Intergenic
1140446542 16:75033553-75033575 TCTCAGCTACTTGGAGGCTGAGG - Intronic
1140514765 16:75533921-75533943 TCTCAGCTACTTGGAGGCTGAGG + Intronic
1140684046 16:77415986-77416008 TATCAGCTCCATGAGGGCTGAGG - Intronic
1142534467 17:604922-604944 TCTAATCTCCATGAGGGCGGAGG - Intronic
1143172989 17:4940763-4940785 TCCCAGCTACATGGGGGCGCCGG - Exonic
1143585151 17:7847209-7847231 TCTCTGCTCCTGGGGGGCGGGGG - Exonic
1143702510 17:8671729-8671751 TCTCAGCTACTTGGGGGCTGAGG + Intergenic
1144450536 17:15374117-15374139 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1145240626 17:21239239-21239261 ACTCAGCTGCAAGGCTGCGGGGG - Exonic
1146249538 17:31326529-31326551 TCTCAGCTACTTGGAGGCTGAGG + Intronic
1146304458 17:31720116-31720138 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1147751402 17:42736715-42736737 TCTCAGCTGCTTGGAGGCTGAGG + Intronic
1148432025 17:47650234-47650256 GATCAGCTCCATGGCGGAGGTGG - Exonic
1149658905 17:58324441-58324463 TCCCCGCTCTACGGCGGCGGCGG + Intronic
1150795598 17:68234330-68234352 TCCCAGCTACATGGAGGCTGGGG + Intergenic
1151483419 17:74383759-74383781 TCCCAGCTACATGGAGGCTGAGG - Intergenic
1151652694 17:75479968-75479990 TCTCAGCTGCTTGGAGGCTGAGG + Intronic
1151987097 17:77550480-77550502 TCTCAGCTACTTGGAGGCTGAGG - Intergenic
1152789915 17:82273370-82273392 TCTCAGCTCCATGGCGGCGGCGG + Exonic
1153192036 18:2551449-2551471 TCTCAGCACTATGGAGGCTGAGG + Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160860713 19:1236322-1236344 TCCCATCCCCATGGCGGGGGAGG + Intronic
1160992328 19:1864793-1864815 TCGCAGGCCCAAGGCGGCGGGGG + Intergenic
1161872435 19:6880777-6880799 TCTCAGGTACATGGAGGCTGAGG - Intergenic
1162270022 19:9606560-9606582 TCCCAGCTCCTTGGAGGCTGAGG + Intronic
1162853553 19:13450550-13450572 TCTCAGCTCCATGAGGACAGGGG + Intronic
1163029159 19:14532427-14532449 TCTCAGCTACTTGGAGGCAGAGG + Intronic
1163430197 19:17262797-17262819 TCTGAGCTCCCTGGAGGCAGCGG - Exonic
1163744482 19:19037067-19037089 TCTCAGCTACTTGGAGGCTGAGG + Intronic
1164686271 19:30168629-30168651 TCTCAGCTCCATGAAGGCAGGGG + Intergenic
1165322948 19:35097432-35097454 TCTCAGCTACTTGGAGGCTGCGG + Intergenic
1166119366 19:40676275-40676297 TCCCAGCTACATGGAGGCTGAGG + Intronic
1166717838 19:44980114-44980136 TCCCAGCTCCAAGGCTGGGGAGG - Intronic
1166778088 19:45324370-45324392 TATCACCTCCAGGACGGCGGGGG - Intergenic
1168095873 19:54114684-54114706 TCTCAGGACCATGGCAGCCGTGG - Exonic
929472415 2:42208548-42208570 TCTCAGCTACTTGGAGGCTGAGG - Intronic
929528188 2:42725863-42725885 TCTCAGCTCCATGATGCTGGGGG - Intronic
930025146 2:47025143-47025165 GCTGAGCTCCAGGCCGGCGGAGG + Intronic
931380691 2:61750579-61750601 TGTAAGCTCCATGGTGGCTGGGG - Intergenic
934967993 2:98739794-98739816 TCTCAGCTCCTTGGCGGGGCAGG - Intergenic
935592620 2:104855845-104855867 GCTCGCCTCCACGGCGGCGGCGG - Exonic
937224286 2:120359321-120359343 TGTGAGCTCCATGGGGGCAGGGG + Intergenic
938924155 2:136024058-136024080 TCCCAGCTACTTGGAGGCGGAGG - Intergenic
939400079 2:141681174-141681196 TCCCAGCTCCTTGGAGGCTGAGG + Intronic
942087099 2:172453911-172453933 GGTCAGCTCCATGGGGGCAGGGG - Intronic
942477166 2:176339564-176339586 TCCCAGCTACATGGAGGCTGAGG - Intergenic
944172792 2:196798406-196798428 TCTCAGCTACTTGGAGGCTGAGG + Intronic
944751847 2:202717354-202717376 TCTCAGCTACTTGGAGGCTGAGG + Intronic
946154504 2:217798452-217798474 TCCCAGCTCCTTGGGGGCTGAGG + Intergenic
946666378 2:222053923-222053945 TCTCAGCTTCTTGGAGGCTGAGG - Intergenic
947558770 2:231126283-231126305 TCCCAGCTACTGGGCGGCGGCGG + Intronic
948023791 2:234759535-234759557 TGTCAGCTACTTGGCGGCAGAGG - Intergenic
948486134 2:238282399-238282421 CCTAAGCTCCATGGGGGCAGGGG + Intronic
948840335 2:240645552-240645574 TCCCAGCTCCAAGGGGGCGGCGG + Intergenic
1169435972 20:5590425-5590447 TCTCAGCTACTTGGAGGCTGAGG + Intronic
1172227705 20:33316280-33316302 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1173188212 20:40857309-40857331 TCACAGTTCCATGGCTGGGGAGG - Intergenic
1173418568 20:42880314-42880336 TCTCAGCTCCCTGGGGACTGAGG + Intronic
1174407609 20:50312346-50312368 TTTCAGCTCCATGAGGGCAGGGG + Intergenic
1175178493 20:57128291-57128313 TCTGAGCTCCATGGTCTCGGTGG - Intergenic
1175418734 20:58817936-58817958 TCTCAGCTCCAAGGAGGCCTTGG + Intergenic
1176105933 20:63386662-63386684 GCTCAGCTCCGTGGCTGCGAAGG + Intergenic
1176744565 21:10640054-10640076 GCTCAGCTCCATGGCTGCCCAGG - Intergenic
1177354245 21:19986907-19986929 TCCCAGCTACATGGGGGCTGAGG - Intergenic
1178201278 21:30408921-30408943 GCTCAGCTCCATGGGAGCAGCGG - Intronic
1178381326 21:32111978-32112000 TATAAGCTCCATGAGGGCGGAGG + Intergenic
1182236957 22:28883661-28883683 TCACAGCCCCATCACGGCGGCGG - Exonic
1182785110 22:32900907-32900929 TATCAGCTACATGACGGCAGCGG + Intronic
1183530093 22:38348685-38348707 TCTGAACTCCATGGAGGAGGTGG - Intronic
1183908134 22:41058329-41058351 TCCCAGCTCCTTGGAGGTGGAGG - Intergenic
1184124453 22:42477159-42477181 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1184469232 22:44686134-44686156 TCTCAGCTACTTGGAGGCTGAGG + Intronic
1184753112 22:46500356-46500378 TCTCTGCGCCATGGGGGAGGGGG - Intronic
950500810 3:13362335-13362357 CCTCAGCTCCATTGCTGTGGGGG + Intronic
953254781 3:41278901-41278923 TCGCAGCCCCATGCCGGCAGCGG + Intronic
953504028 3:43465535-43465557 TCTCAGCTGCTTGGAGGCTGAGG + Intronic
954185694 3:48915595-48915617 TCTCAGCTCCACAGCTGAGGGGG - Intergenic
955138337 3:56243281-56243303 TCTCAGCTCCTTGAAGGTGGAGG - Intronic
959061046 3:101616576-101616598 TCTCAGCTCTTTGGCTGAGGTGG - Intergenic
959352242 3:105280489-105280511 TCCCAGCTACATGGAGGCTGAGG - Intergenic
961635430 3:128329953-128329975 TCACTGCTCCATGGCGGTGATGG + Intronic
967953323 3:194857588-194857610 TCTCAGCTCCATAGTGTCGCTGG + Intergenic
968334165 3:197899469-197899491 TCCCAGCTCCTTGGAGGCTGAGG + Intronic
969089889 4:4685821-4685843 TCCCTGCTCCATGGGGGCAGGGG + Intergenic
971421045 4:26474506-26474528 TCTGAGCTCCCTGGATGCGGAGG - Intergenic
972578740 4:40376101-40376123 TCTCAGCTACTTGGGGGCTGAGG - Intergenic
973259203 4:48144097-48144119 TCTCAGCTACTTGGGGGCTGAGG + Intronic
974499308 4:62678053-62678075 TCACAGTTCCATGACGGGGGAGG - Intergenic
974802620 4:66838002-66838024 TCCCAGCTACTTGGCGGCTGAGG - Intergenic
977315511 4:95442580-95442602 TCTCAGCTACTTGGGGGCTGGGG - Intronic
978510049 4:109507388-109507410 TCTCAGCTACTTGGTGGCTGAGG - Intronic
980611204 4:135166340-135166362 TCTCAGCTACTTGGAGGCTGAGG - Intergenic
982695938 4:158600709-158600731 TCTCAGCTACTTGGAGGCTGAGG + Intronic
982712209 4:158768950-158768972 CCGCAGCCCCACGGCGGCGGCGG - Intergenic
984298839 4:177889313-177889335 TCTCAGCTACTTGGAGGCTGAGG + Intronic
985537683 5:473903-473925 TCTCAGCTCCCTGGGAGCGCAGG + Intronic
986265915 5:6190240-6190262 TCTCAGCTCCACGACAGCAGTGG + Intergenic
987807280 5:22785632-22785654 TCTCAGCTACTTGGAGGCTGAGG - Intronic
988173071 5:27683869-27683891 TCACAGTTCCATGTGGGCGGGGG + Intergenic
988184911 5:27847497-27847519 TCTCAGCTTAATGGCAGGGGTGG + Intergenic
988433584 5:31147900-31147922 TCTGAGGTCCATGGGGGCAGGGG - Intergenic
988491527 5:31709369-31709391 TCCCAGCTACATGGAGGCTGAGG + Intronic
989052566 5:37335833-37335855 TCCCAGCTACATGGCGGGGAGGG + Intronic
990410611 5:55537371-55537393 TCCCAGCTACATGGAGGCTGAGG + Intergenic
991093010 5:62710924-62710946 TCTCAGCTACTTGGAGGCTGAGG - Intergenic
991340035 5:65598630-65598652 TCTCAGCTACAAGGAGGCTGAGG + Intronic
992501809 5:77350791-77350813 TCTCAGCCCTATGGCTGCTGTGG - Intronic
993771447 5:91932818-91932840 TCTTAGCTCCATGAGGGCAGGGG + Intergenic
994851129 5:105056916-105056938 TCTCTGCTCCATGGAGTGGGAGG - Intergenic
997275719 5:132586746-132586768 TCTCAGCTACTTGGAGGCTGAGG + Intronic
997292426 5:132747517-132747539 TCTGAGCTCGACGGCTGCGGCGG - Exonic
997999589 5:138614400-138614422 TCTCAGCTACACGGAGGCTGAGG - Intronic
998236489 5:140402387-140402409 GGTCGGCTCCATGGCGGCGGTGG + Intronic
998318168 5:141202726-141202748 TCCCAGCTACTTGGAGGCGGAGG - Exonic
998531156 5:142886027-142886049 TCACAGCTCCACGGCTGCGATGG - Intronic
1000220188 5:159208228-159208250 TCTTAGCCCCGCGGCGGCGGCGG - Intronic
1001692863 5:173645825-173645847 TCTCAGTTCGAGGGTGGCGGGGG + Intergenic
1002087123 5:176782985-176783007 TCTCAGCTACTTAGCGGCTGAGG - Intergenic
1002498170 5:179629906-179629928 TCTCAGCTACTTGGAGGCTGAGG + Intronic
1002530254 5:179840291-179840313 TCCCAGCTACTTGGCGGCTGAGG + Intronic
1002543845 5:179925230-179925252 TCTCCGCTCCCTGGAGGCTGGGG - Intronic
1003659823 6:8049825-8049847 TCTCAGCTACTTGGGGGCTGAGG - Intronic
1004365335 6:15008143-15008165 TCCCAGCTACTTGGAGGCGGAGG - Intergenic
1005919641 6:30389089-30389111 TCTCAGCTACCTGGGGGCTGAGG - Intergenic
1006467264 6:34203096-34203118 TGTCGGCTCCATGGAGCCGGAGG + Intergenic
1006523403 6:34585143-34585165 ACACAGCTCCATGACGGCAGGGG + Intergenic
1008357832 6:50575842-50575864 TCTCAGCTACTTGGAGGCTGGGG - Intergenic
1008380076 6:50831437-50831459 TCTCAACTCCATGGCGGGAGTGG + Intronic
1011590405 6:88965699-88965721 TCCCAGCTCCTTGGGGGCTGAGG - Intergenic
1011625504 6:89280091-89280113 TCTCAGCTACTTGGAGGCTGAGG + Intronic
1011856767 6:91702814-91702836 TGTAAGCTCCATGAGGGCGGAGG - Intergenic
1012567846 6:100682306-100682328 TCTCATCTCCATGAGGGCAGGGG - Intronic
1014896780 6:126910896-126910918 TCACAGTTCCATGGCTGGGGAGG - Intergenic
1017019721 6:150130505-150130527 TCTCAGCTTCATGGCAGATGGGG + Intergenic
1017500339 6:155017895-155017917 TCACAGCCCCATGGGGCCGGTGG - Intronic
1017790311 6:157792255-157792277 TCCCAGCTACTTGGAGGCGGAGG - Intronic
1018992972 6:168688035-168688057 TCTAATCTCCATGGGGGGGGTGG - Intergenic
1019678436 7:2329949-2329971 TCTCAGCTACATGGGGCGGGGGG - Intronic
1019679064 7:2334584-2334606 TCTCAGCTACTTGGGGGCTGAGG + Intronic
1024230577 7:47360568-47360590 ACTCAGCTCCCTGGAGGGGGTGG + Intronic
1025907889 7:65802587-65802609 TCTCAACACCATGGAGGCAGTGG - Intergenic
1026023180 7:66726478-66726500 TCTCAGCTACTTGGAGGCTGAGG - Intronic
1026522010 7:71125842-71125864 TCTCAGCTGCTTGGAGGCTGAGG - Intergenic
1026887935 7:73965374-73965396 TCTCAGCTACTTGGAGGCTGAGG - Intergenic
1029526085 7:101094804-101094826 GATCAGCTACATGGGGGCGGGGG + Intergenic
1029645971 7:101856062-101856084 TCTCAGCTCCTTGGGGGCTGAGG + Intronic
1032240132 7:130153700-130153722 CCTCAGCTCCAGGGAGGCGCCGG + Intergenic
1033245750 7:139715052-139715074 TCTCAGCTCCATGTCGGCAGCGG + Intronic
1034187234 7:149187696-149187718 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1034808079 7:154106071-154106093 TCTCCTCTCCATGGGGGCTGTGG - Intronic
1035005511 7:155655802-155655824 TCTCAGCTACTTGGAGGCTGAGG + Intronic
1036641295 8:10585671-10585693 TCTAAGCTCCTTGGCAGCTGAGG - Intergenic
1037132184 8:15420380-15420402 TCTCAGCTACTTGGAGGCTGAGG + Intronic
1037740377 8:21604203-21604225 TCTCCTCTCCATGGGGGAGGTGG - Intergenic
1038635370 8:29282405-29282427 TCTCAGCTGCAGGGAGGCTGAGG - Intergenic
1038959770 8:32506131-32506153 TCTCAGCTACATGAAGGCTGAGG + Intronic
1039454278 8:37697228-37697250 ACTCAACTCGGTGGCGGCGGCGG + Exonic
1039880720 8:41623952-41623974 TCTCAGCTACTTGGAGGCTGAGG - Exonic
1040935046 8:52773702-52773724 TCTCAGCTACTTGGGGGCTGAGG + Intergenic
1041365580 8:57100064-57100086 TCTCTGCTGCATGGAGGCTGAGG + Intergenic
1041894616 8:62908718-62908740 TCACAGCTCCATGGCTGAGGAGG - Intronic
1041935801 8:63330525-63330547 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1042131183 8:65588075-65588097 TCTCAGCTACTTGGTGGCTGAGG - Intergenic
1042283245 8:67078459-67078481 TCTCAGCTACTTGGAGGCTGAGG - Intronic
1042918956 8:73902758-73902780 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1044525980 8:93251472-93251494 TTTCAGCTGCATGGGGACGGGGG - Intergenic
1045328599 8:101136054-101136076 TCCCAGCTCCTTGGAGGCTGAGG - Intergenic
1047208813 8:122824291-122824313 TCTCAGCTCCATGAGGACAGAGG + Intronic
1048763663 8:137824310-137824332 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1049362411 8:142218572-142218594 TCACAGCTCCCTGGCAGCTGAGG - Intronic
1051423349 9:16910499-16910521 TATGAGCTCCATCGCAGCGGAGG + Intergenic
1051874730 9:21779533-21779555 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1051876870 9:21802765-21802787 TCTCACCTTCACGGCGGTGGTGG - Exonic
1053597544 9:39578085-39578107 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1053855559 9:42335056-42335078 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1054568721 9:66786915-66786937 TCTCAGCTACTTGGAGGCTGAGG - Intergenic
1055305397 9:74924060-74924082 TCCCAGCTCCATGGGGGTGGGGG + Intergenic
1055552655 9:77445624-77445646 TCTCAGCTACTTGGCGACTGAGG + Intronic
1055954328 9:81760429-81760451 TCTCAGCTACTTGGAGGCTGGGG - Intergenic
1056220931 9:84450174-84450196 TCTCAGCTCCATGGGGACAGAGG + Intergenic
1057991170 9:99771734-99771756 TCTCAGCTGCTTGGAGGCTGAGG - Intergenic
1059222301 9:112635364-112635386 TCTCAGCTACTTGGAGGCTGAGG - Intronic
1059410403 9:114128385-114128407 TCTCAGCTCCATGATGTCTGGGG - Intergenic
1059464186 9:114456711-114456733 TGTCAGCTCCTTGGAGGCTGAGG + Intronic
1059768026 9:117402315-117402337 TCCCAGCTCTTTGGAGGCGGAGG - Intronic
1061786397 9:133031046-133031068 CCTCAGCTCCACGGGGACGGCGG - Exonic
1185989308 X:4875354-4875376 TCTCATCTCCATGCTGGTGGTGG - Intergenic
1186047668 X:5553452-5553474 TCTCAGCTACTTGGAGGCTGAGG + Intergenic
1189834519 X:45006168-45006190 TCTTGGCAACATGGCGGCGGGGG - Intronic
1190828702 X:54042183-54042205 TCTCAGCTACTTGGAGGCTGGGG + Intronic
1191648618 X:63510846-63510868 TCTGAGCTCCATGGCGACTGAGG + Intergenic
1192173169 X:68869299-68869321 TGTAAGCTCCATGAAGGCGGGGG + Intergenic
1192795474 X:74421627-74421649 TTGCAGCGCCATCGCGGCGGGGG - Exonic
1193131834 X:77928503-77928525 TCTCTGCCCCATGGAGGCAGTGG - Intronic
1194062426 X:89221103-89221125 TCTCAGCTACTTGGAGGCTGAGG - Intergenic
1198263845 X:134991134-134991156 CATCAGGTCCATGGCGGCGGCGG + Exonic
1200503448 Y:3981664-3981686 TCTCTGCTCTATGGCCACGGAGG + Intergenic
1200716296 Y:6550069-6550091 TCTCAGCTACTTGGAGGCTGAGG - Intergenic
1200781774 Y:7223144-7223166 TCTCAGCTACTTGGAGGCTGAGG - Intergenic