ID: 1152790056

View in Genome Browser
Species Human (GRCh38)
Location 17:82273850-82273872
Sequence CAGGAGCCTGCACGTGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152790056_1152790062 -9 Left 1152790056 17:82273850-82273872 CCCCTTCCACGTGCAGGCTCCTG 0: 1
1: 0
2: 4
3: 29
4: 218
Right 1152790062 17:82273864-82273886 AGGCTCCTGCTGCTCTCGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 147
1152790056_1152790061 -10 Left 1152790056 17:82273850-82273872 CCCCTTCCACGTGCAGGCTCCTG 0: 1
1: 0
2: 4
3: 29
4: 218
Right 1152790061 17:82273863-82273885 CAGGCTCCTGCTGCTCTCGCGGG 0: 1
1: 0
2: 3
3: 26
4: 302
1152790056_1152790065 21 Left 1152790056 17:82273850-82273872 CCCCTTCCACGTGCAGGCTCCTG 0: 1
1: 0
2: 4
3: 29
4: 218
Right 1152790065 17:82273894-82273916 GTGTGTCCCCCGAGATGTCGAGG 0: 1
1: 0
2: 1
3: 1
4: 41
1152790056_1152790063 -8 Left 1152790056 17:82273850-82273872 CCCCTTCCACGTGCAGGCTCCTG 0: 1
1: 0
2: 4
3: 29
4: 218
Right 1152790063 17:82273865-82273887 GGCTCCTGCTGCTCTCGCGGGGG 0: 1
1: 0
2: 0
3: 29
4: 196
1152790056_1152790069 29 Left 1152790056 17:82273850-82273872 CCCCTTCCACGTGCAGGCTCCTG 0: 1
1: 0
2: 4
3: 29
4: 218
Right 1152790069 17:82273902-82273924 CCCGAGATGTCGAGGAAGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152790056 Original CRISPR CAGGAGCCTGCACGTGGAAG GGG (reversed) Intergenic
903759443 1:25687498-25687520 CAGGAGCCTGTATCTGTAAGGGG - Intronic
904442960 1:30543626-30543648 CAGGAGACAGGAGGTGGAAGTGG + Intergenic
905034254 1:34906958-34906980 CAGGAGCCTGGTCGAGGATGAGG - Intronic
905920516 1:41715934-41715956 GAGGTGCCTTCACATGGAAGTGG + Intronic
906087991 1:43152377-43152399 CAGGAGCCAGCCCTGGGAAGAGG - Intronic
906314245 1:44776018-44776040 GAGATGCCTGCATGTGGAAGCGG - Exonic
906685213 1:47758778-47758800 CAGGCTCCTGGACATGGAAGAGG + Intergenic
911293751 1:96088302-96088324 CAGGTGATTGCACGTGGGAGGGG - Intergenic
912332802 1:108834858-108834880 CTGGAGGCTGCATGAGGAAGGGG + Intronic
912935503 1:114000685-114000707 CAGAACCCTGCACTTAGAAGGGG + Intergenic
914513099 1:148351895-148351917 CAGGAGAAAGCAGGTGGAAGAGG + Intergenic
915002893 1:152609683-152609705 CAGGAGACTGGAGTTGGAAGGGG + Intergenic
917070714 1:171147677-171147699 CAGAAGCCTTCAAGGGGAAGAGG + Exonic
917795168 1:178528117-178528139 CAGAACCCTGCACTTGGCAGGGG + Intronic
917804415 1:178600334-178600356 CAGGAGACTGGACGTGGGTGAGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
920445749 1:206014910-206014932 CAGGACCCTCCATGTGGGAGAGG + Intronic
920457410 1:206111712-206111734 CAGGGGCATGCTCGTGGATGTGG + Intronic
921257633 1:213356831-213356853 TAGGAGCCTGCCTGGGGAAGAGG + Intergenic
921877798 1:220218853-220218875 CAGGAGCTTGCAGTTGGAATAGG - Intronic
922745228 1:228039475-228039497 CAGGAGCCTGCCAGGAGAAGGGG - Intronic
923402866 1:233632048-233632070 CAGCAGCACGCACGTGGAAGAGG - Intronic
923519496 1:234724984-234725006 CAGGAGCCAGTACGTGGCTGTGG + Intergenic
1063787692 10:9403669-9403691 CTGGAGCCTGCAACTCGAAGAGG + Intergenic
1064097711 10:12436199-12436221 GTGAAGCCTGTACGTGGAAGAGG - Intronic
1064247809 10:13683198-13683220 CACCACCGTGCACGTGGAAGGGG - Intronic
1066980522 10:42409823-42409845 CAGGAGTCTTCACTTTGAAGTGG + Intergenic
1069955006 10:72044615-72044637 CTGGAGGCTGCCCGTGGAGGTGG - Intergenic
1070338207 10:75473520-75473542 CAGCAGCCTGCATTTGGAGGTGG + Intronic
1070648379 10:78217574-78217596 CAGGTGCCAGCAGGTGGAATTGG - Intergenic
1073321205 10:102617280-102617302 CAGGAGCCTGCCCCTGGAGATGG - Exonic
1075091724 10:119447553-119447575 CAGGGAGCTGCACGGGGAAGAGG - Intronic
1076735823 10:132458509-132458531 CCAGAGCCGGCAGGTGGAAGTGG + Intergenic
1077423518 11:2463819-2463841 AGGGAGCCTCCACGTGGTAGCGG - Intronic
1077747516 11:4923805-4923827 CATGAGCCAGCACATGGGAGTGG + Exonic
1077913729 11:6597154-6597176 TAGGAGCCTGCACTGGGAAAGGG + Exonic
1078105938 11:8358008-8358030 CAGGAGCCTGTATGGGGAGGCGG - Intergenic
1079617969 11:22518532-22518554 CAGCTGCCTACACATGGAAGAGG + Intergenic
1080551376 11:33376318-33376340 CAGGAGCCGGCCCGGGGGAGGGG + Intergenic
1083554381 11:63614236-63614258 CAGGAGGCTGCAGGTGCCAGCGG + Exonic
1083680523 11:64349635-64349657 CAGGGCCCTGCAGCTGGAAGAGG + Exonic
1084970928 11:72771699-72771721 CTGGAGCCTGGAGGTGGAGGTGG - Intronic
1088409884 11:109522604-109522626 CAGGAGCCTACATGGGTAAGAGG + Intergenic
1089502458 11:118940520-118940542 CAGGTCCCTGCAAGTGGAAGTGG + Intronic
1089668630 11:120036161-120036183 CAGGAGCCTAGAGGAGGAAGAGG - Intergenic
1090619556 11:128549056-128549078 CCGGAGCCTGCAGCTGGAGGAGG - Intronic
1090788476 11:130070003-130070025 CAGGAGCCTGCCCGTGGCTGCGG - Exonic
1092001756 12:5038621-5038643 CACCAGCCTGCCCGTGGAGGAGG + Intergenic
1095964619 12:47858543-47858565 CAGAAGCCTGCAGGTGGTGGTGG - Intronic
1096256438 12:50064879-50064901 CAGGACCTGGCACATGGAAGTGG - Intronic
1096720187 12:53515576-53515598 GAGAAGCCTTAACGTGGAAGAGG + Exonic
1096771802 12:53939915-53939937 CTGGAGCCTGCAAGGGGAGGCGG - Intronic
1097258382 12:57697760-57697782 CAGGAGACTGCACCAGGCAGAGG - Intronic
1100631982 12:96399413-96399435 GAGGAGCCCGCGCGTGGGAGCGG - Intronic
1100919087 12:99462275-99462297 AAGCAGCTTGCACCTGGAAGGGG - Intronic
1101633690 12:106519855-106519877 CAGGAGCCCGCACATGAAACAGG + Intronic
1102034178 12:109761499-109761521 CAGCAGCCTGCCTGGGGAAGAGG - Intronic
1102039796 12:109793609-109793631 CAGGAGGGGGCACGTGAAAGGGG + Intronic
1104787343 12:131457987-131458009 GAGGAGCCTACAGGTGGAGGGGG - Intergenic
1104990623 12:132622032-132622054 TAGGGACCTGCACGTGGACGTGG + Intronic
1105708465 13:22983083-22983105 CAGCAGCCTGCACATGGCATGGG + Intergenic
1106101441 13:26697377-26697399 CAGGAGCATGCACGGGGCACTGG + Intergenic
1106101447 13:26697408-26697430 CAGGAGCATGCACGGGGTACTGG + Intergenic
1106101453 13:26697439-26697461 CAGGAGCGTGCACGGGGCACTGG + Intergenic
1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG + Intronic
1110333039 13:74294665-74294687 CAAGAGAATGCATGTGGAAGAGG - Intergenic
1110980274 13:81889188-81889210 CAGGTGCCTGTAGGAGGAAGAGG - Intergenic
1117081344 14:52155235-52155257 CAGGAGGCTGCTAGAGGAAGTGG - Intergenic
1121321340 14:92993380-92993402 CAGGAGCCTGCAGCTGGCAGGGG + Intronic
1122007267 14:98715964-98715986 AAGGAGCCTGCACGAGTTAGGGG + Intronic
1122408562 14:101514419-101514441 CTGGAGCCTGGACATGGAGGGGG - Intergenic
1122409111 14:101517085-101517107 CTGGAGCCAGCACCTGGGAGGGG - Intergenic
1123002619 14:105304045-105304067 GAGGTGCCTGCAGGTGCAAGGGG + Exonic
1123975888 15:25554238-25554260 CAACAGCCTGCAGCTGGAAGAGG + Intergenic
1125957314 15:43799403-43799425 CAGGCGGCTGCAAGTGGATGCGG + Exonic
1126274224 15:46857312-46857334 AAGAAGCATGCACGTGGATGGGG - Intergenic
1130086670 15:80783519-80783541 CAGGAGGCTGGAAGTGGCAGTGG + Intronic
1130577613 15:85106297-85106319 GAGGAGCCTGGAGGGGGAAGTGG - Intronic
1130747113 15:86666851-86666873 CAGGACCCTGCAGTTAGAAGTGG + Intronic
1132233965 15:100205498-100205520 CAGGACCCATCACGTGGGAGGGG + Intronic
1132956424 16:2596743-2596765 CAGGAGCCTGCGCTTGGAAGTGG - Intronic
1136141710 16:28292754-28292776 CCGGATCCTGGATGTGGAAGGGG - Exonic
1138177431 16:54913493-54913515 CAAAAGCCTGCAAGTGGAAGTGG + Intergenic
1138234938 16:55374136-55374158 CATGTCCCTGCACGTGGATGAGG - Intergenic
1139960261 16:70713525-70713547 CAGGGGAATGGACGTGGAAGAGG + Intronic
1140289770 16:73642322-73642344 CAGGAGCCTGAAGGTGGGAAGGG - Intergenic
1140831077 16:78751942-78751964 CTGGTGCCTCCACGTGGAAGTGG + Intronic
1141365397 16:83437974-83437996 TAGGAGCATGCACATGGGAGTGG - Intronic
1141759065 16:86015362-86015384 CAGGAGGCCCCACGTGGAACTGG - Intergenic
1142263025 16:89051325-89051347 CAGGAGCCTCCACCTTGAAGGGG - Intergenic
1143270846 17:5673382-5673404 CAGGGGGCTGCAGGTGGAAGAGG + Intergenic
1144948520 17:18981955-18981977 CAGGAGCCTGCAGGAGGCGGTGG - Intronic
1145269869 17:21399099-21399121 CAGGAGGCTGGAGGTGGAAGCGG + Intronic
1148150357 17:45393479-45393501 CAGGAGCCTTCTCCTGCAAGAGG - Intergenic
1148579519 17:48734129-48734151 CCGGAGCCTGCGCTTGGCAGGGG + Intergenic
1148769975 17:50061020-50061042 CAGAGGCCTGCACATGGATGGGG - Intronic
1152021441 17:77781933-77781955 CAGGACCCTGGACGTTGAAGGGG - Intergenic
1152106290 17:78331066-78331088 CAGGAGCCGGCACGTGGTAGTGG - Intergenic
1152227268 17:79098247-79098269 CAGGACTCAGCACGGGGAAGAGG - Intronic
1152447626 17:80355224-80355246 CAGAAGCTTGGACCTGGAAGGGG - Intronic
1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG + Intergenic
1152790056 17:82273850-82273872 CAGGAGCCTGCACGTGGAAGGGG - Intergenic
1154982910 18:21518812-21518834 TAGGAGCCTGGAGGTGCAAGTGG - Intronic
1155451041 18:25963058-25963080 CAGGTCCATGCAAGTGGAAGAGG - Intergenic
1156486309 18:37468095-37468117 CAGGATCGTTCATGTGGAAGAGG + Intronic
1157061233 18:44292923-44292945 CAGGAGCCTGCAAGGGGTGGGGG + Intergenic
1157330377 18:46699820-46699842 CAGGAACCTCCACCTGGCAGAGG + Intronic
1157879271 18:51304662-51304684 CAGGAGCTAGGACCTGGAAGCGG - Intergenic
1158441783 18:57481334-57481356 CAAGAGCCTGCAGGGGGAAAAGG - Exonic
1158614153 18:58970447-58970469 CAGATGCCTGCAAGTAGAAGGGG + Intronic
1159961798 18:74560945-74560967 CAGCAGGCTGCACGTCCAAGTGG - Exonic
1160222549 18:76988113-76988135 CAGGAACCCGCATGTGGAAGTGG - Intronic
1160265308 18:77336629-77336651 CTGGAGCCTGCACAGGGAACCGG + Intergenic
1161735152 19:5987646-5987668 CATGAGCCAGGTCGTGGAAGTGG + Intergenic
1162727566 19:12699304-12699326 CGGGAGCCCGCAGGGGGAAGAGG + Exonic
1164402837 19:27913473-27913495 CTGGAGCCTGCAGGTGGCAGAGG + Intergenic
1164846399 19:31436720-31436742 CAGGCTCCAGCAGGTGGAAGTGG - Intergenic
1165773028 19:38389315-38389337 CAGCAGCCTGCAGGTGGGGGAGG + Intronic
1166122992 19:40696684-40696706 CAGGAGGCTCCACGTGGATGGGG - Intronic
1166131495 19:40748562-40748584 AAGGAGGCTGCCTGTGGAAGTGG - Intronic
1166685412 19:44793542-44793564 CAGTAGCCTGACCGTGGAACTGG - Exonic
1166798801 19:45443725-45443747 CAGGAACCTGGAAGTGGCAGGGG + Intronic
1166895910 19:46021889-46021911 CAGAGGCCTGCAGGTGGCAGGGG - Intronic
1167755240 19:51408881-51408903 CAGGAGACTGCATGTGGATGGGG - Intergenic
925914541 2:8595474-8595496 CAGGAGCCCGGAGGTGGACGGGG - Intergenic
926698345 2:15785906-15785928 CAGGAGCCATTCCGTGGAAGGGG + Intergenic
927035760 2:19174497-19174519 CAGGGGTCTGGAGGTGGAAGTGG + Intergenic
930611914 2:53553853-53553875 CTTGAGCCTGCAGGGGGAAGGGG - Intronic
932024503 2:68119800-68119822 CAGGAGCCTGAAAGGGGAGGAGG - Intergenic
932667318 2:73708145-73708167 CAAGAGCCTGCACGTGGGAGGGG - Intergenic
935635785 2:105248797-105248819 CATGAGCCGGAACATGGAAGTGG - Intergenic
935636876 2:105255837-105255859 CAGGAGCCTTCCCGTGGTTGTGG - Intergenic
936064779 2:109322405-109322427 CAGGAGCCTGAACTAGGAGGCGG + Intronic
937292272 2:120788821-120788843 CAGGGGCCTGCAAGTTGAGGGGG - Intronic
938302171 2:130224097-130224119 CAGGAGCCTGGCAGTTGAAGAGG - Intergenic
938454507 2:131450168-131450190 CAGGAGCCTGGCAGTTGAAGAGG + Intergenic
947523755 2:230866279-230866301 CAGAAGCCTGCATCTGGAAGTGG - Intronic
947868652 2:233419656-233419678 CAGAAAGCTGCAGGTGGAAGAGG + Intronic
948185689 2:236019623-236019645 CAGCAGCCTGCACCTGGACGGGG + Intronic
948198880 2:236115157-236115179 CAGGAGCTCACCCGTGGAAGCGG - Intronic
948570195 2:238912987-238913009 CAGGAGCCAGCACAGGGAAGTGG - Intergenic
948800759 2:240432471-240432493 CAGCAGCCTGAAGGAGGAAGTGG - Intergenic
1168859527 20:1036194-1036216 CAGGGACCTGCAGGTGGAAAGGG - Intergenic
1170266627 20:14473291-14473313 CAGGAGGCTACAGGTGGATGTGG - Intronic
1172095587 20:32458532-32458554 CAGGAGCCTCCACGGGGGACAGG + Intronic
1172240365 20:33408872-33408894 CTGCAGCCTGCACGTGGAATGGG - Exonic
1172367769 20:34363227-34363249 CAGGCGCCTGAGCGCGGAAGTGG - Intronic
1174313152 20:49675130-49675152 CACCAGGCTGCTCGTGGAAGGGG - Intronic
1174681718 20:52415098-52415120 CAGAGTCCTGCACTTGGAAGTGG + Intergenic
1175886681 20:62295906-62295928 CAGGAGCCTGGTCCTAGAAGAGG - Exonic
1176019044 20:62953287-62953309 CTGGAGCCTGCAGCTGGACGGGG + Intronic
1176414001 21:6464467-6464489 CAGGTGCCTCATCGTGGAAGTGG - Intergenic
1178366467 21:31992655-31992677 GAGGAGCTTGCATGTGGAAGGGG + Intronic
1179000799 21:37456290-37456312 CAGGAGGCTGCAGGTGGAGGTGG + Intronic
1179689499 21:43072789-43072811 CAGGTGCCTCATCGTGGAAGTGG - Intronic
1180095743 21:45554612-45554634 CAGGTCCCTGCACGGGGCAGCGG + Intergenic
1180174743 21:46082145-46082167 CAGGAGCCTGGACGGCAAAGAGG + Intergenic
1180616808 22:17133702-17133724 GAGGGGCTTGCACGTGTAAGGGG + Intergenic
1180964047 22:19776461-19776483 CAGGGGCCTGCACGGGGTGGAGG + Intronic
1181077492 22:20391311-20391333 CAGGAACCTGTACATGGGAGTGG - Intergenic
1183455183 22:37918694-37918716 CAGGAGCCGCCAAGGGGAAGGGG + Intronic
1184463169 22:44651736-44651758 AAGGAGTCTGCTCGTGGCAGAGG - Intergenic
1185044992 22:48524320-48524342 CATGAGCCTGCACCTGAAAGAGG - Intronic
1185326763 22:50229493-50229515 CAGCAGCCTGCTCTCGGAAGTGG - Exonic
949982077 3:9508280-9508302 GGGGAGCCTGCATCTGGAAGAGG - Intronic
950285621 3:11742506-11742528 CAGCAGCCAGCAAGTGGAAATGG - Intergenic
955029162 3:55199794-55199816 AAGGAGCCTGGATGTGAAAGAGG + Intergenic
956779605 3:72593670-72593692 CAGGAGCATGCCTGTGGGAGTGG - Intergenic
957942795 3:87026342-87026364 AAGGAGCATGCAATTGGAAGAGG + Intergenic
960527760 3:118729625-118729647 CAGGAACCTGCAACTGGAAATGG - Intergenic
961019870 3:123496503-123496525 GAGGAGGCAGCACGTGGAACAGG + Intronic
961538714 3:127586194-127586216 CAGGAGCTTACAGCTGGAAGCGG + Intronic
966878386 3:184336230-184336252 GAGGAGCCTGCACCGGGAGGCGG + Intronic
968817225 4:2828389-2828411 CGGGAGCCTGAAGGTGGGAGTGG - Intronic
969535654 4:7754940-7754962 CAGGAGCCTGAACCTGGGAATGG + Intergenic
970009826 4:11446888-11446910 CAGGAGGCTGGACCTGGGAGGGG + Intergenic
970531915 4:16993563-16993585 CTGGAGCATCCAGGTGGAAGGGG - Intergenic
971954354 4:33396462-33396484 CAGGAGCCAGGACCTGGAACTGG - Intergenic
972232108 4:37085626-37085648 CAGGAGCCGGCAGGTGGCTGGGG + Intergenic
982165063 4:152606780-152606802 CAGGACTCTGAAGGTGGAAGAGG + Intergenic
983729144 4:170971842-170971864 AATGAGCCTGCATCTGGAAGTGG - Intergenic
985680458 5:1253245-1253267 GAGGACCCTGCACCTGGATGGGG - Exonic
986478299 5:8158503-8158525 CAGGAACCTGCACTTGGGAGGGG - Intergenic
986829591 5:11561015-11561037 CAGGAGCCTCAACCTGGACGAGG + Intronic
988428733 5:31094033-31094055 CTGCAGCCTGCACACGGAAGAGG - Intergenic
995543080 5:113203167-113203189 CAGGGGCCTGAACCTGCAAGAGG + Intronic
998474815 5:142411768-142411790 CAGGAGCCTCTAAGTGGAAGTGG + Intergenic
1003173883 6:3740723-3740745 CATGAGCCTGGAGGTGGAGGAGG - Intronic
1003192371 6:3885917-3885939 CAGAGGCCTGAAAGTGGAAGAGG - Intergenic
1006295399 6:33167846-33167868 CAGGACCCTGCAGGTGGAGTGGG + Exonic
1015209108 6:130676361-130676383 CAGGAGCCAGCAGCTGGAAAAGG - Intergenic
1015372007 6:132464876-132464898 CAGGGGCCTGGAGGTGGAACGGG + Intronic
1016989469 6:149919379-149919401 CAGGAAATTGCAAGTGGAAGAGG - Intronic
1017529636 6:155275938-155275960 TCGCAGCCTGCACGTGGATGGGG - Exonic
1017630163 6:156389318-156389340 CAGAAGCCTTGACGTGGATGAGG + Intergenic
1018072147 6:160174249-160174271 CGGGAGGCTGAACGGGGAAGAGG + Intronic
1018210941 6:161481014-161481036 CAGGCAGCAGCACGTGGAAGTGG + Intronic
1018471441 6:164101382-164101404 GGGGAGCCTGCATGTGGAGGAGG - Intergenic
1018471447 6:164101403-164101425 GGGGAGCCTGCAGGTGGAGGAGG - Intergenic
1018471471 6:164101466-164101488 GGGGAGCCTGCAGGTGGAGGAGG - Intergenic
1018471478 6:164101487-164101509 GGGGAGCCTGCAGGTGGAGGAGG - Intergenic
1018471485 6:164101508-164101530 GGGGAGCCTGCAGGTGGAGGAGG - Intergenic
1018471492 6:164101529-164101551 GGGGAGCCTGCAGGTGGAGGAGG - Intergenic
1018471511 6:164101592-164101614 GAGGAGCCTGCAGGTGGAGGAGG - Intergenic
1018471545 6:164101739-164101761 GAAGAGCCTGCAGGTGGAGGAGG - Intergenic
1018471556 6:164101781-164101803 GGGGAGCCTGCAGGTGGAGGAGG - Intergenic
1018471563 6:164101802-164101824 GAAGAGCCTGCAGGTGGAGGAGG - Intergenic
1019177013 6:170165179-170165201 CAGGAGTCTGTAGCTGGAAGTGG - Intergenic
1022475230 7:30705717-30705739 AAGGAGCCTGCACATGGGACAGG - Intronic
1023417874 7:39949799-39949821 CAGGAGCCTCCTCGTGGAGGGGG + Intergenic
1023656330 7:42425183-42425205 CAGGAACCTAGAGGTGGAAGTGG + Intergenic
1023854059 7:44170314-44170336 TAGGAGCCTACACCTGGAAATGG + Intronic
1024723841 7:52169706-52169728 CAGGAGCCTGCAGGAGCCAGTGG - Intergenic
1025851848 7:65250723-65250745 CAAGAGCCTGAACATGGATGGGG - Intergenic
1026017512 7:66682584-66682606 CAGCATCCTGGACGGGGAAGTGG - Intronic
1026030612 7:66789914-66789936 CAGTTGCCAGCACTTGGAAGAGG + Intronic
1027207511 7:76113314-76113336 CAGTTGCCAGCACTTGGAAGAGG - Intergenic
1028490268 7:91403689-91403711 CAGGTGCCAGCATGTGGATGGGG + Intergenic
1029437288 7:100570354-100570376 CAGCAGCCTGCGCGTGGCGGCGG + Intergenic
1029735206 7:102461891-102461913 GAGGAGCCTGGAGATGGAAGAGG - Intronic
1031402540 7:121342585-121342607 CATGACCCTGGAAGTGGAAGTGG + Intergenic
1032082985 7:128869397-128869419 AAGGAGCCTGCGCGGGGCAGGGG - Intronic
1032383475 7:131506144-131506166 CATGTGCCTGCATGTAGAAGAGG - Intronic
1034567006 7:151923440-151923462 CAGCAGGCTGCAAGTGAAAGAGG - Intergenic
1035689853 8:1553080-1553102 CAGGAGCCTTCCCGGGGAGGCGG - Intronic
1036629434 8:10500256-10500278 AAGGATACTGCAGGTGGAAGGGG - Intergenic
1037827767 8:22169450-22169472 CAAGATCCTGCACGGGGAAGTGG + Intronic
1038798225 8:30727827-30727849 CAGGGCCATGCACGCGGAAGTGG + Exonic
1043876605 8:85492977-85492999 CAGGAGCCTGCAGGTGCAAGTGG + Intergenic
1043929523 8:86075048-86075070 CACGTGCATGCACTTGGAAGGGG - Intronic
1045333477 8:101177888-101177910 CAGAAGCCTGCACGAAGAGGTGG - Intronic
1049647336 8:143741382-143741404 CAGGAGCCTGTACCTGGAGAAGG + Intergenic
1051359713 9:16271046-16271068 CAGCAGTCTGCAAGTGGAAGAGG + Intronic
1051505972 9:17828200-17828222 CAGGAGGCTGCACATGGGACTGG - Intergenic
1053784710 9:41645733-41645755 CAGGAACGTGCCGGTGGAAGGGG - Intergenic
1054173438 9:61859678-61859700 CAGGAACATGCCGGTGGAAGGGG - Intergenic
1054664104 9:67721103-67721125 CAGGAACATGCCGGTGGAAGGGG + Intergenic
1055938638 9:81627448-81627470 CAGGAGCCTGTACCAGGTAGAGG - Intronic
1057036848 9:91817502-91817524 GAGGAGCCTGCAAGTTGCAGGGG - Intronic
1060529824 9:124341625-124341647 AAGGGGCCTGCAGGTGAAAGGGG + Intronic
1060982641 9:127802716-127802738 CAGGATGGTGCACGCGGAAGGGG + Intronic
1061039367 9:128130970-128130992 CACAAGCCTCCACGTGGAAAAGG - Intergenic
1061404280 9:130384964-130384986 CAGGAGCCTGGCTGGGGAAGGGG + Intronic
1062389716 9:136329127-136329149 CAGGAGCCAGCCCCTGGCAGGGG + Intronic
1062401979 9:136376746-136376768 CAGGAGGCTGTACATGGATGGGG + Intronic
1062630577 9:137461409-137461431 CTGGAGCCTGGGCGTGGACGTGG + Intronic
1062675955 9:137743922-137743944 CAGCAGCCTGCACGTGAATGGGG + Exonic
1186695437 X:12025784-12025806 CAGGAGTGTGAACTTGGAAGTGG + Intergenic
1188086802 X:25908893-25908915 CAGGAGTCTGCAAATGGCAGTGG - Intergenic
1190780791 X:53592944-53592966 CAGGAGCCAGGAGGTGGAGGGGG - Intronic
1190967133 X:55311604-55311626 CAGTAGCCTGCCCTTGCAAGGGG + Intergenic
1201679445 Y:16627087-16627109 CAGGGTACTGCACATGGAAGTGG + Intergenic