ID: 1152790414

View in Genome Browser
Species Human (GRCh38)
Location 17:82275613-82275635
Sequence TACGTCCTGCCGGGAGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152790414_1152790420 -1 Left 1152790414 17:82275613-82275635 CCCAGAGCTCCCGGCAGGACGTA No data
Right 1152790420 17:82275635-82275657 ATGAGGGCCAGCCCACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152790414 Original CRISPR TACGTCCTGCCGGGAGCTCT GGG (reversed) Intergenic