ID: 1152790528

View in Genome Browser
Species Human (GRCh38)
Location 17:82276356-82276378
Sequence CTCTGGAAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152790528_1152790535 10 Left 1152790528 17:82276356-82276378 CCATCCACCTTGGCCTTCCAGAG No data
Right 1152790535 17:82276389-82276411 ACACGCATGAGCTACCATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152790528 Original CRISPR CTCTGGAAGGCCAAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr