ID: 1152791698

View in Genome Browser
Species Human (GRCh38)
Location 17:82283595-82283617
Sequence ATGGCTGCCGATTCACTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152791698_1152791704 6 Left 1152791698 17:82283595-82283617 CCACCCAGTGAATCGGCAGCCAT No data
Right 1152791704 17:82283624-82283646 TTCCCTAGCACCTCCTCCCCAGG No data
1152791698_1152791705 7 Left 1152791698 17:82283595-82283617 CCACCCAGTGAATCGGCAGCCAT No data
Right 1152791705 17:82283625-82283647 TCCCTAGCACCTCCTCCCCAGGG No data
1152791698_1152791710 19 Left 1152791698 17:82283595-82283617 CCACCCAGTGAATCGGCAGCCAT No data
Right 1152791710 17:82283637-82283659 CCTCCCCAGGGTGTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152791698 Original CRISPR ATGGCTGCCGATTCACTGGG TGG (reversed) Intergenic