ID: 1152791705

View in Genome Browser
Species Human (GRCh38)
Location 17:82283625-82283647
Sequence TCCCTAGCACCTCCTCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152791702_1152791705 3 Left 1152791702 17:82283599-82283621 CCAGTGAATCGGCAGCCATGGGA No data
Right 1152791705 17:82283625-82283647 TCCCTAGCACCTCCTCCCCAGGG No data
1152791696_1152791705 19 Left 1152791696 17:82283583-82283605 CCTCTGCAGGGGCCACCCAGTGA No data
Right 1152791705 17:82283625-82283647 TCCCTAGCACCTCCTCCCCAGGG No data
1152791700_1152791705 4 Left 1152791700 17:82283598-82283620 CCCAGTGAATCGGCAGCCATGGG No data
Right 1152791705 17:82283625-82283647 TCCCTAGCACCTCCTCCCCAGGG No data
1152791698_1152791705 7 Left 1152791698 17:82283595-82283617 CCACCCAGTGAATCGGCAGCCAT No data
Right 1152791705 17:82283625-82283647 TCCCTAGCACCTCCTCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152791705 Original CRISPR TCCCTAGCACCTCCTCCCCA GGG Intergenic