ID: 1152791708

View in Genome Browser
Species Human (GRCh38)
Location 17:82283634-82283656
Sequence GGGTGGACACCCTGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152791708_1152791720 10 Left 1152791708 17:82283634-82283656 CCTCCTCCCCAGGGTGTCCACCC No data
Right 1152791720 17:82283667-82283689 CTTTCTCTGCCGCCTCCTCCAGG No data
1152791708_1152791721 14 Left 1152791708 17:82283634-82283656 CCTCCTCCCCAGGGTGTCCACCC No data
Right 1152791721 17:82283671-82283693 CTCTGCCGCCTCCTCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152791708 Original CRISPR GGGTGGACACCCTGGGGAGG AGG (reversed) Intergenic
No off target data available for this crispr