ID: 1152791710

View in Genome Browser
Species Human (GRCh38)
Location 17:82283637-82283659
Sequence CCTCCCCAGGGTGTCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152791700_1152791710 16 Left 1152791700 17:82283598-82283620 CCCAGTGAATCGGCAGCCATGGG No data
Right 1152791710 17:82283637-82283659 CCTCCCCAGGGTGTCCACCCAGG No data
1152791702_1152791710 15 Left 1152791702 17:82283599-82283621 CCAGTGAATCGGCAGCCATGGGA No data
Right 1152791710 17:82283637-82283659 CCTCCCCAGGGTGTCCACCCAGG No data
1152791703_1152791710 0 Left 1152791703 17:82283614-82283636 CCATGGGAACTTCCCTAGCACCT No data
Right 1152791710 17:82283637-82283659 CCTCCCCAGGGTGTCCACCCAGG No data
1152791698_1152791710 19 Left 1152791698 17:82283595-82283617 CCACCCAGTGAATCGGCAGCCAT No data
Right 1152791710 17:82283637-82283659 CCTCCCCAGGGTGTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152791710 Original CRISPR CCTCCCCAGGGTGTCCACCC AGG Intergenic