ID: 1152791864

View in Genome Browser
Species Human (GRCh38)
Location 17:82284426-82284448
Sequence TCTTGCTCTGTCACCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 549577
Summary {0: 26457, 1: 73050, 2: 147182, 3: 159645, 4: 143243}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152791864_1152791870 25 Left 1152791864 17:82284426-82284448 CCAGCCTGGGTGACAGAGCAAGA 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
Right 1152791870 17:82284474-82284496 AAAAAAGGCAGAAAGCAGTGGGG No data
1152791864_1152791872 29 Left 1152791864 17:82284426-82284448 CCAGCCTGGGTGACAGAGCAAGA 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
Right 1152791872 17:82284478-82284500 AAGGCAGAAAGCAGTGGGGGAGG No data
1152791864_1152791868 23 Left 1152791864 17:82284426-82284448 CCAGCCTGGGTGACAGAGCAAGA 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
Right 1152791868 17:82284472-82284494 AAAAAAAAGGCAGAAAGCAGTGG No data
1152791864_1152791871 26 Left 1152791864 17:82284426-82284448 CCAGCCTGGGTGACAGAGCAAGA 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
Right 1152791871 17:82284475-82284497 AAAAAGGCAGAAAGCAGTGGGGG No data
1152791864_1152791869 24 Left 1152791864 17:82284426-82284448 CCAGCCTGGGTGACAGAGCAAGA 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
Right 1152791869 17:82284473-82284495 AAAAAAAGGCAGAAAGCAGTGGG No data
1152791864_1152791873 30 Left 1152791864 17:82284426-82284448 CCAGCCTGGGTGACAGAGCAAGA 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
Right 1152791873 17:82284479-82284501 AGGCAGAAAGCAGTGGGGGAGGG No data
1152791864_1152791867 10 Left 1152791864 17:82284426-82284448 CCAGCCTGGGTGACAGAGCAAGA 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
Right 1152791867 17:82284459-82284481 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152791864 Original CRISPR TCTTGCTCTGTCACCCAGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr