ID: 1152791865

View in Genome Browser
Species Human (GRCh38)
Location 17:82284430-82284452
Sequence GGAGTCTTGCTCTGTCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421846
Summary {0: 11170, 1: 44232, 2: 101511, 3: 128684, 4: 136249}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152791865_1152791869 20 Left 1152791865 17:82284430-82284452 CCTGGGTGACAGAGCAAGACTCC 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
Right 1152791869 17:82284473-82284495 AAAAAAAGGCAGAAAGCAGTGGG No data
1152791865_1152791868 19 Left 1152791865 17:82284430-82284452 CCTGGGTGACAGAGCAAGACTCC 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
Right 1152791868 17:82284472-82284494 AAAAAAAAGGCAGAAAGCAGTGG No data
1152791865_1152791867 6 Left 1152791865 17:82284430-82284452 CCTGGGTGACAGAGCAAGACTCC 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
Right 1152791867 17:82284459-82284481 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
1152791865_1152791873 26 Left 1152791865 17:82284430-82284452 CCTGGGTGACAGAGCAAGACTCC 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
Right 1152791873 17:82284479-82284501 AGGCAGAAAGCAGTGGGGGAGGG No data
1152791865_1152791871 22 Left 1152791865 17:82284430-82284452 CCTGGGTGACAGAGCAAGACTCC 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
Right 1152791871 17:82284475-82284497 AAAAAGGCAGAAAGCAGTGGGGG No data
1152791865_1152791870 21 Left 1152791865 17:82284430-82284452 CCTGGGTGACAGAGCAAGACTCC 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
Right 1152791870 17:82284474-82284496 AAAAAAGGCAGAAAGCAGTGGGG No data
1152791865_1152791872 25 Left 1152791865 17:82284430-82284452 CCTGGGTGACAGAGCAAGACTCC 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
Right 1152791872 17:82284478-82284500 AAGGCAGAAAGCAGTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152791865 Original CRISPR GGAGTCTTGCTCTGTCACCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr