ID: 1152791866

View in Genome Browser
Species Human (GRCh38)
Location 17:82284451-82284473
Sequence TTTTTTTTTTTTTTTTGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 496384
Summary {0: 83672, 1: 60776, 2: 74199, 3: 114646, 4: 163091}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152791866_1152791868 -2 Left 1152791866 17:82284451-82284473 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1152791868 17:82284472-82284494 AAAAAAAAGGCAGAAAGCAGTGG No data
1152791866_1152791869 -1 Left 1152791866 17:82284451-82284473 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1152791869 17:82284473-82284495 AAAAAAAGGCAGAAAGCAGTGGG No data
1152791866_1152791874 10 Left 1152791866 17:82284451-82284473 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1152791874 17:82284484-82284506 GAAAGCAGTGGGGGAGGGAGAGG No data
1152791866_1152791876 21 Left 1152791866 17:82284451-82284473 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1152791876 17:82284495-82284517 GGGAGGGAGAGGGAAGAATGAGG No data
1152791866_1152791873 5 Left 1152791866 17:82284451-82284473 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1152791873 17:82284479-82284501 AGGCAGAAAGCAGTGGGGGAGGG No data
1152791866_1152791870 0 Left 1152791866 17:82284451-82284473 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1152791870 17:82284474-82284496 AAAAAAGGCAGAAAGCAGTGGGG No data
1152791866_1152791872 4 Left 1152791866 17:82284451-82284473 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1152791872 17:82284478-82284500 AAGGCAGAAAGCAGTGGGGGAGG No data
1152791866_1152791875 11 Left 1152791866 17:82284451-82284473 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1152791875 17:82284485-82284507 AAAGCAGTGGGGGAGGGAGAGGG No data
1152791866_1152791871 1 Left 1152791866 17:82284451-82284473 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1152791871 17:82284475-82284497 AAAAAGGCAGAAAGCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152791866 Original CRISPR TTTTTTTTTTTTTTTTGAGA CGG (reversed) Intergenic
Too many off-targets to display for this crispr