ID: 1152791867

View in Genome Browser
Species Human (GRCh38)
Location 17:82284459-82284481
Sequence AAAAAAAAAAAAAAAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322213
Summary {0: 22235, 1: 21563, 2: 42018, 3: 80771, 4: 155626}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152791863_1152791867 20 Left 1152791863 17:82284416-82284438 CCACTGCACTCCAGCCTGGGTGA 0: 81688
1: 171766
2: 204013
3: 179579
4: 118739
Right 1152791867 17:82284459-82284481 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
1152791865_1152791867 6 Left 1152791865 17:82284430-82284452 CCTGGGTGACAGAGCAAGACTCC 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
Right 1152791867 17:82284459-82284481 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
1152791864_1152791867 10 Left 1152791864 17:82284426-82284448 CCAGCCTGGGTGACAGAGCAAGA 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
Right 1152791867 17:82284459-82284481 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152791867 Original CRISPR AAAAAAAAAAAAAAAAAAAA AGG Intergenic
Too many off-targets to display for this crispr