ID: 1152791871

View in Genome Browser
Species Human (GRCh38)
Location 17:82284475-82284497
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152791865_1152791871 22 Left 1152791865 17:82284430-82284452 CCTGGGTGACAGAGCAAGACTCC 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
Right 1152791871 17:82284475-82284497 AAAAAGGCAGAAAGCAGTGGGGG No data
1152791864_1152791871 26 Left 1152791864 17:82284426-82284448 CCAGCCTGGGTGACAGAGCAAGA 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
Right 1152791871 17:82284475-82284497 AAAAAGGCAGAAAGCAGTGGGGG No data
1152791866_1152791871 1 Left 1152791866 17:82284451-82284473 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1152791871 17:82284475-82284497 AAAAAGGCAGAAAGCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152791871 Original CRISPR AAAAAGGCAGAAAGCAGTGG GGG Intergenic
No off target data available for this crispr