ID: 1152792762

View in Genome Browser
Species Human (GRCh38)
Location 17:82290993-82291015
Sequence GAGGGGTCTTTTCAGTAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152792762 Original CRISPR GAGGGGTCTTTTCAGTAGTT GGG Intergenic
901925310 1:12562199-12562221 GAGAGGTCGTTTCACTATTTTGG - Intergenic
902739262 1:18423453-18423475 GAGGGGTCCATTCAGTTGGTTGG - Intergenic
908671718 1:66555441-66555463 CAGGGCTCTTTTCTGTACTTGGG - Intronic
909960912 1:81841397-81841419 GTAGGGTCTTTTCAGTATTTGGG + Intronic
910796981 1:91107306-91107328 GAAGGGTCTATTCAGTCATTTGG + Intergenic
915666510 1:157450013-157450035 GGGGGGTCTATTCAGTCTTTTGG + Intergenic
918363036 1:183778611-183778633 GAGGGTTCTTTAAAGAAGTTGGG + Intronic
918726630 1:187933977-187933999 CAGGGTACTTTTCAGAAGTTTGG - Intergenic
920940014 1:210473427-210473449 GAGGGGTCCATTCAGTTGATTGG + Intronic
922612571 1:226940999-226941021 GGGGGGTCTTGTGAGTGGTTTGG + Intronic
924055462 1:240119880-240119902 TAGGGCTATTTTCAGTAATTCGG + Intronic
924938287 1:248790736-248790758 GAGGGGTCTGTTCAGTTGGTTGG + Intergenic
1065265443 10:23970720-23970742 GAGGGGTCTATTCAGTTGGTTGG - Intronic
1068086309 10:52377328-52377350 GAAGGGTCTTTTCAAAAGTGAGG + Intergenic
1073379621 10:103067932-103067954 GAGGGGTCTGCTCAGTGGTCAGG + Intronic
1074593537 10:114838792-114838814 GAGGGGTGTTCTCTGTAGTGAGG - Intronic
1077795492 11:5487185-5487207 GATTGGTCTTTTCATTGGTTAGG + Intronic
1079005473 11:16788806-16788828 GAGGGGCCTTTGCAGGCGTTCGG - Exonic
1080959082 11:37136792-37136814 CAGGGCTCTTTTCAGTTGGTAGG - Intergenic
1083466068 11:62847103-62847125 GAGGGGGCTTATCAGAAGCTTGG + Intergenic
1084635807 11:70391785-70391807 GAAGGGTCTATTCAGTTGGTTGG - Intergenic
1084877406 11:72143238-72143260 GAGGTGTCCATTCAGTTGTTTGG - Intergenic
1084882565 11:72182041-72182063 GAGGTGTCCATTCAGTTGTTTGG - Intergenic
1088054012 11:105553434-105553456 GAGGGGTCCATTCAGTTGTCTGG + Intergenic
1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG + Intronic
1090898743 11:131005970-131005992 GAGCTATCTTTTCAGTAGTGAGG - Intergenic
1091215170 11:133896905-133896927 GCGGGGTCTTCTCAGTGTTTGGG + Intergenic
1091365675 11:135018008-135018030 GAAGTGTCTATTCAGTTGTTTGG - Intergenic
1091397180 12:161122-161144 GGGGTGTCCTTTCAGTAGCTGGG + Intronic
1094212376 12:27905986-27906008 GAGGGGTCCATCCAGTTGTTTGG + Intergenic
1097281458 12:57847183-57847205 GAGCGGCCTTTTAAATAGTTGGG - Intergenic
1098528272 12:71511665-71511687 GAGGTGTCACTTAAGTAGTTGGG - Intronic
1099534614 12:83828470-83828492 GAGGGGAGTGTCCAGTAGTTCGG + Intergenic
1101675761 12:106914802-106914824 GAGGGGCCTTTTCACAAGTCAGG - Intergenic
1101713023 12:107286397-107286419 GAGGGGTCCATTCAGATGTTTGG - Intergenic
1102444436 12:112990933-112990955 GAGGGGTTCATTCAGTAGGTTGG + Intronic
1104392575 12:128403396-128403418 GTGGGCTCTTTTCAGGACTTTGG - Intronic
1105565343 13:21540515-21540537 GATGTGGCTTTTCTGTAGTTTGG + Intronic
1105883776 13:24625135-24625157 GAGGGATCTTTTCAGAAGCTTGG - Intergenic
1108767893 13:53656777-53656799 GAGGGGTCTTATTTGTAATTAGG - Intergenic
1109434068 13:62275190-62275212 GAGGGGTCCATTCAGTTGGTTGG + Intergenic
1109929816 13:69200934-69200956 GAGGGATGTATTCAGTATTTGGG + Intergenic
1111895953 13:94141609-94141631 GAGGGGTCCGTTCAGTTGGTGGG + Intronic
1113918657 13:113890830-113890852 GAGGGGTCTGTTCAGTCAGTTGG - Intergenic
1113971871 13:114197493-114197515 GAGGGGTCTGTTCAGTTGGCTGG + Intergenic
1117235393 14:53769200-53769222 GAAGGGTCTTATAAGTGGTTTGG + Intergenic
1120732155 14:88015948-88015970 GAGGGGTCTTTTCAGTCAGTTGG - Intergenic
1125803563 15:42472608-42472630 AAGGAGTCGTTTCAGTAGTAGGG - Intronic
1128916465 15:71567230-71567252 GAGAGGTCTTTGCTTTAGTTTGG + Intronic
1129263337 15:74381102-74381124 GAGGGGCCTTTTCAGAATTTAGG - Intergenic
1129754821 15:78091708-78091730 GAGGGGACTTTGGAGTAGATGGG - Intronic
1131453672 15:92566503-92566525 GGGGGGTCCATTCAGTAGTCTGG - Intergenic
1131599982 15:93837372-93837394 GAGGGGTCCATTCAGTCATTTGG + Intergenic
1131744652 15:95434123-95434145 GAGGGTTCTATTCAGAACTTTGG - Intergenic
1134002122 16:10791023-10791045 GAGGGGTCCATTCAGTTGGTTGG + Intronic
1134866292 16:17610364-17610386 GAGGGGTCTCTTCAGGTGGTTGG - Intergenic
1137075848 16:35959534-35959556 GAGGGATATTTTGAGTAGTTTGG + Intergenic
1138898466 16:61239701-61239723 GAGGGGTCCATTCAGTTGGTTGG - Intergenic
1139222480 16:65197953-65197975 GAAGGGAATTTTCAGTAGATGGG - Intergenic
1145024440 17:19457347-19457369 GAGGGGTCTGTACAGATGTTTGG + Intergenic
1145031866 17:19510552-19510574 GAGGGGTCCGTTCCGTTGTTTGG + Intronic
1145204620 17:20976491-20976513 GAGGGGTCTGTGCAGGAGTTTGG - Intergenic
1149206150 17:54250936-54250958 GAGGTCTCTTTTGAGGAGTTTGG + Intergenic
1150076704 17:62198350-62198372 CAGGGGTCTTTGCAGCAGTGGGG + Intergenic
1150963776 17:69944165-69944187 GAGTGGCCTTTTCAGTTATTGGG + Intergenic
1152792762 17:82290993-82291015 GAGGGGTCTTTTCAGTAGTTGGG + Intergenic
1152980182 18:268949-268971 CGGGGGTCTGTTCAGTTGTTGGG - Intergenic
1154388690 18:13918218-13918240 GATGGGTATGTTCAGTAGATTGG - Intergenic
1155565611 18:27131202-27131224 GAGGGGTCTATTTAGTCGGTGGG - Intronic
1155669346 18:28349922-28349944 GAGGGATCTCTTCAGTTGGTTGG + Intergenic
1156834867 18:41540395-41540417 GATGCATCTTATCAGTAGTTGGG + Intergenic
1157074414 18:44449469-44449491 CAGGGGACATTTCAGTAGCTTGG - Intergenic
1157877417 18:51286830-51286852 GAGGGTTCTTATGAGTAATTTGG + Intergenic
1158997578 18:62938799-62938821 GAGGGGTTTTTTAAGTTGCTTGG + Intronic
1160094042 18:75854396-75854418 ATGGGGTCTTTTCAATAGCTTGG - Intergenic
1161138169 19:2633001-2633023 GTGGGGTCTGTTGAGAAGTTAGG - Intronic
1163747758 19:19058177-19058199 GAGGGGTCTCTTCCATAGCTTGG + Exonic
1165414305 19:35682688-35682710 GAAGGGTATTTTCAGTCTTTAGG - Intergenic
1165692070 19:37871377-37871399 GAGGGGTCCATTCAGTTGTTTGG + Intergenic
927279056 2:21287542-21287564 TATGGGTCTTTTGAGCAGTTGGG + Intergenic
927829000 2:26332165-26332187 TAGAGATCTGTTCAGTAGTTGGG + Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
932864417 2:75326531-75326553 GAGGTGACTTATCAGTGGTTTGG + Intergenic
937951577 2:127391964-127391986 GAGGGGTCTATTCAGGTGGTTGG + Intergenic
939665687 2:144948562-144948584 GAAGGGTCTTTGGAGTATTTGGG + Intergenic
942097731 2:172549178-172549200 GAGGGGTCCATTCAGTTGGTTGG - Intergenic
943722220 2:191216982-191217004 GAGAGATCTTTTCAGAAATTTGG + Intergenic
944141233 2:196459466-196459488 AGGGGGTCTGTTCAGTAGGTTGG - Intronic
945118126 2:206429588-206429610 GAAGGGTCCTTTGAGTACTTAGG + Intergenic
948433896 2:237939148-237939170 GAGGGGTCTCTTCAGTCAGTTGG + Intergenic
1170059312 20:12242927-12242949 ATGGGGTCTTTACAGAAGTTAGG + Intergenic
1170574890 20:17654787-17654809 GTGGGTTCATCTCAGTAGTTCGG - Intronic
1171323884 20:24273541-24273563 GAGGGGTGTTTATAGTAGTTAGG - Intergenic
1174143413 20:48433069-48433091 GAGGGGTCCATTCAGTTGCTTGG - Intergenic
1177336062 21:19729367-19729389 GCGTTGTCATTTCAGTAGTTGGG + Intergenic
1178179832 21:30147084-30147106 GAGGAGCCTTATCAGAAGTTTGG + Intergenic
1179267473 21:39817068-39817090 CTGGAGTCTTCTCAGTAGTTGGG - Intergenic
1179417540 21:41210215-41210237 GAAGGGTCTGTTCAGTTGGTGGG - Intronic
1179601169 21:42477796-42477818 AAGTGGTCTTTTCAATTGTTCGG + Intronic
1180607960 22:17075481-17075503 AAGGGGACATTTCAGTAGTGTGG + Intergenic
1180873259 22:19159970-19159992 GGGGGATCTTTTCAGTTGGTGGG - Intergenic
1182120779 22:27785306-27785328 GAGGGGGTTTTTCCGTTGTTAGG - Intronic
949558252 3:5177873-5177895 GAGGTGCTTCTTCAGTAGTTGGG + Intronic
952015174 3:28948263-28948285 GATTCGTCATTTCAGTAGTTTGG + Intergenic
954037210 3:47857662-47857684 GAGGGCTCTTTTAAGTACTTAGG - Intronic
955142878 3:56287036-56287058 GAGGGGTCTCTTAAGTGTTTCGG - Intronic
963226533 3:142868305-142868327 GAGGGGTCCATTCAGTTGGTTGG - Intronic
963472260 3:145754971-145754993 AAGGGGTCTTTTCACAACTTTGG - Intergenic
964255992 3:154774597-154774619 GAGGTGTCTATTCAGGGGTTTGG + Intergenic
964575959 3:158168892-158168914 AGGGGGTCTGTTCAGTTGTTTGG - Intronic
966455687 3:180113497-180113519 GAAAGGTATTTTCAGTAGTTGGG - Intergenic
967912957 3:194557006-194557028 AAGGGGCCATTTGAGTAGTTCGG - Intergenic
971307515 4:25496579-25496601 AAAGGGTCTTTTCAGTAGAAAGG + Intergenic
973143079 4:46793143-46793165 GAGGGGGCTTATCAGAAGTTTGG + Intronic
974633908 4:64533529-64533551 GAGGAGTCTATTCAGTTGGTTGG + Intergenic
974674571 4:65073458-65073480 GAGGGGGCTTATCAGAAGCTTGG - Intergenic
975509498 4:75178111-75178133 GAGGGCTGTTTTCAGTCATTTGG + Intergenic
978551182 4:109928925-109928947 GAGGGGTCTATTCAGTTGGTTGG + Intronic
978826188 4:113026885-113026907 GGTGGCTTTTTTCAGTAGTTGGG + Intronic
980496975 4:133598762-133598784 GAGGGGGCTTATCAGAAGCTTGG + Intergenic
980521604 4:133943387-133943409 GAGGGGTCTATTCAGTCAGTTGG + Intergenic
985140703 4:186837704-186837726 GAAGCCTCCTTTCAGTAGTTAGG - Intergenic
986112697 5:4735602-4735624 GAGGGGTCTTTTTAGTGATCTGG - Intergenic
986565415 5:9108850-9108872 GAGTGGTCTTTTAAATTGTTTGG - Intronic
988679711 5:33473075-33473097 GAGGGGTCCATTCAGTTGATTGG - Intergenic
989193244 5:38691487-38691509 GAGGGGTCTTATCAGAACTGTGG - Intergenic
993514134 5:88808947-88808969 AAGAGGTTTTTACAGTAGTTAGG + Intronic
994541000 5:101097130-101097152 GAGGTGTCTATTCAGGACTTTGG + Intergenic
994777198 5:104049712-104049734 GGGGGATCTTTTCAGTCTTTGGG + Intergenic
1000874759 5:166622399-166622421 GAGGGATCTTTGCAGAAATTGGG + Intergenic
1002155125 5:177271824-177271846 GATGGCTGTTTTAAGTAGTTTGG + Intronic
1002157463 5:177294408-177294430 CAGAGGTCTTTCCAGTGGTTGGG - Exonic
1003431669 6:6044077-6044099 GGGGGGTCTCTTCATTTGTTGGG - Intergenic
1005141931 6:22642018-22642040 GAGCGGTCTTTTCAGAAGCGTGG + Intergenic
1007786729 6:44284516-44284538 AAGGGGTCATTTCGTTAGTTGGG - Intronic
1008610165 6:53178205-53178227 GAGGGATCTTTAGAGAAGTTAGG - Intergenic
1009511159 6:64551495-64551517 GAGGGGTCTCTTCAGTTGATTGG - Intronic
1012227187 6:96717792-96717814 GAGGGGTCTATTCAGTTGGTTGG - Intergenic
1013419243 6:109951125-109951147 GAGGGGTCTATTCAGATGGTTGG + Intergenic
1014154015 6:118090982-118091004 GATGGGACTTGTCAGTAGATTGG + Intronic
1016699323 6:147035782-147035804 GAGGGGTCTATTCAGTCAGTTGG + Intergenic
1017650041 6:156572338-156572360 CAGTGGTCTTCTCATTAGTTCGG + Intergenic
1018912729 6:168112233-168112255 GAGGGGTCTGTTCAGTTCCTGGG + Intergenic
1019585944 7:1803602-1803624 GAGGGGGCTTATCACAAGTTTGG + Intergenic
1019779757 7:2932324-2932346 GAGGGGACCTTTCAGCAGTTGGG + Intronic
1023335246 7:39162259-39162281 GAGGAATATTTACAGTAGTTAGG + Intronic
1024305456 7:47925527-47925549 GAGGGGTCCATTCAGTAGGTTGG - Intronic
1024319314 7:48049123-48049145 GAGGGGGCTTATCAGAAGCTTGG - Intronic
1027616632 7:80431963-80431985 GAGGAGTCTGTTCAGTTGGTTGG + Intronic
1040450787 8:47544090-47544112 GAGGGTTCTGTTCAGTTGGTTGG + Intronic
1041097763 8:54366352-54366374 GAGGGAGCTTTTCAGTGGTCAGG - Intergenic
1042908573 8:73800717-73800739 GAAAGTTCTTTTTAGTAGTTTGG - Intronic
1043765286 8:84123277-84123299 AAGGGGTCTATTCAGTTGGTTGG - Intergenic
1044031384 8:87241944-87241966 GAGGGGTCTATTCAGTTGGCTGG - Intronic
1046228268 8:111315866-111315888 GGTGGGTCTTTTCTGTAGTTAGG + Intergenic
1051160306 9:14200101-14200123 AAGGGGTGTGCTCAGTAGTTGGG + Intronic
1056955994 9:91081709-91081731 GAGGGGTCCATTCAGTTGGTAGG + Intergenic
1057389419 9:94630325-94630347 GAGGGTTTTTTTCAGGAGTTGGG - Intronic
1058416916 9:104798626-104798648 GAGGGGTCTTTGATGCAGTTAGG + Intronic
1187118007 X:16373390-16373412 GAGGGGGCTTATCAGAAGCTTGG + Intergenic
1188896262 X:35672022-35672044 CATGTGTCTTTTCAGTAGTTTGG + Intergenic
1189070727 X:37861035-37861057 GAGGGGGCTTATCACTAGCTTGG - Intronic
1192731996 X:73809772-73809794 GAGGGGTCCATTCAGTTGGTTGG - Intergenic
1196075082 X:111567545-111567567 GAGGGGTCCATTCAGTTGGTTGG - Intergenic
1199223703 X:145346746-145346768 TAGGGGTCTTCTCAATTGTTTGG + Intergenic
1200299760 X:154961670-154961692 AAGGGGTCTCTTCAGTCGTTTGG - Intronic