ID: 1152793143

View in Genome Browser
Species Human (GRCh38)
Location 17:82292980-82293002
Sequence AGACCCAGGAGGGCCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152793134_1152793143 13 Left 1152793134 17:82292944-82292966 CCTTCCGCTCGCCGCGTCTGGCG No data
Right 1152793143 17:82292980-82293002 AGACCCAGGAGGGCCCGGCCAGG No data
1152793135_1152793143 9 Left 1152793135 17:82292948-82292970 CCGCTCGCCGCGTCTGGCGATCG No data
Right 1152793143 17:82292980-82293002 AGACCCAGGAGGGCCCGGCCAGG No data
1152793137_1152793143 2 Left 1152793137 17:82292955-82292977 CCGCGTCTGGCGATCGCGGCTAC No data
Right 1152793143 17:82292980-82293002 AGACCCAGGAGGGCCCGGCCAGG No data
1152793133_1152793143 14 Left 1152793133 17:82292943-82292965 CCCTTCCGCTCGCCGCGTCTGGC No data
Right 1152793143 17:82292980-82293002 AGACCCAGGAGGGCCCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152793143 Original CRISPR AGACCCAGGAGGGCCCGGCC AGG Intergenic
No off target data available for this crispr