ID: 1152794211

View in Genome Browser
Species Human (GRCh38)
Location 17:82298891-82298913
Sequence GACCTCCGGCTTGTCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152794211_1152794219 13 Left 1152794211 17:82298891-82298913 CCTGGGGTGACAAGCCGGAGGTC No data
Right 1152794219 17:82298927-82298949 TGGAGACCGTGTTCAGAAGGAGG No data
1152794211_1152794218 10 Left 1152794211 17:82298891-82298913 CCTGGGGTGACAAGCCGGAGGTC No data
Right 1152794218 17:82298924-82298946 GACTGGAGACCGTGTTCAGAAGG No data
1152794211_1152794217 -7 Left 1152794211 17:82298891-82298913 CCTGGGGTGACAAGCCGGAGGTC No data
Right 1152794217 17:82298907-82298929 GGAGGTCTGGGAGATGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152794211 Original CRISPR GACCTCCGGCTTGTCACCCC AGG (reversed) Intergenic
No off target data available for this crispr