ID: 1152795286

View in Genome Browser
Species Human (GRCh38)
Location 17:82303443-82303465
Sequence CTGTGGGTAAGGAAGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152795271_1152795286 8 Left 1152795271 17:82303412-82303434 CCATTTCCCAAATCCCACAGCAG No data
Right 1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG No data
1152795272_1152795286 2 Left 1152795272 17:82303418-82303440 CCCAAATCCCACAGCAGCCCCCA No data
Right 1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG No data
1152795273_1152795286 1 Left 1152795273 17:82303419-82303441 CCAAATCCCACAGCAGCCCCCAG No data
Right 1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG No data
1152795269_1152795286 22 Left 1152795269 17:82303398-82303420 CCAGCCTCTGGGAGCCATTTCCC No data
Right 1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG No data
1152795275_1152795286 -6 Left 1152795275 17:82303426-82303448 CCACAGCAGCCCCCAGTCTGTGG No data
Right 1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG No data
1152795274_1152795286 -5 Left 1152795274 17:82303425-82303447 CCCACAGCAGCCCCCAGTCTGTG No data
Right 1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG No data
1152795270_1152795286 18 Left 1152795270 17:82303402-82303424 CCTCTGGGAGCCATTTCCCAAAT No data
Right 1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152795286 Original CRISPR CTGTGGGTAAGGAAGGAAAG GGG Intergenic
No off target data available for this crispr