ID: 1152797176

View in Genome Browser
Species Human (GRCh38)
Location 17:82314206-82314228
Sequence GTGAGTGAGGGGCAGGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152797165_1152797176 17 Left 1152797165 17:82314166-82314188 CCAGTGCGGCAGGAGGAAGGGCT No data
Right 1152797176 17:82314206-82314228 GTGAGTGAGGGGCAGGTGTGAGG No data
1152797160_1152797176 30 Left 1152797160 17:82314153-82314175 CCGGGTTAACGCGCCAGTGCGGC No data
Right 1152797176 17:82314206-82314228 GTGAGTGAGGGGCAGGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152797176 Original CRISPR GTGAGTGAGGGGCAGGTGTG AGG Intergenic
No off target data available for this crispr