ID: 1152797176 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:82314206-82314228 |
| Sequence | GTGAGTGAGGGGCAGGTGTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1152797165_1152797176 | 17 | Left | 1152797165 | 17:82314166-82314188 | CCAGTGCGGCAGGAGGAAGGGCT | No data | ||
| Right | 1152797176 | 17:82314206-82314228 | GTGAGTGAGGGGCAGGTGTGAGG | No data | ||||
| 1152797160_1152797176 | 30 | Left | 1152797160 | 17:82314153-82314175 | CCGGGTTAACGCGCCAGTGCGGC | No data | ||
| Right | 1152797176 | 17:82314206-82314228 | GTGAGTGAGGGGCAGGTGTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1152797176 | Original CRISPR | GTGAGTGAGGGGCAGGTGTG AGG | Intergenic | ||
| No off target data available for this crispr | |||||