ID: 1152802009

View in Genome Browser
Species Human (GRCh38)
Location 17:82334883-82334905
Sequence GGAATCTGACCTCTGTGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152802009_1152802022 14 Left 1152802009 17:82334883-82334905 CCGGGGCACAGAGGTCAGATTCC No data
Right 1152802022 17:82334920-82334942 CGGGGAAACCCCAGCCACCCTGG No data
1152802009_1152802012 -4 Left 1152802009 17:82334883-82334905 CCGGGGCACAGAGGTCAGATTCC No data
Right 1152802012 17:82334902-82334924 TTCCCCAGCCCCCGCCCTCGGGG No data
1152802009_1152802010 -6 Left 1152802009 17:82334883-82334905 CCGGGGCACAGAGGTCAGATTCC No data
Right 1152802010 17:82334900-82334922 GATTCCCCAGCCCCCGCCCTCGG No data
1152802009_1152802011 -5 Left 1152802009 17:82334883-82334905 CCGGGGCACAGAGGTCAGATTCC No data
Right 1152802011 17:82334901-82334923 ATTCCCCAGCCCCCGCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152802009 Original CRISPR GGAATCTGACCTCTGTGCCC CGG (reversed) Intergenic
No off target data available for this crispr