ID: 1152802014

View in Genome Browser
Species Human (GRCh38)
Location 17:82334905-82334927
Sequence TTTCCCCGAGGGCGGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152802014_1152802022 -8 Left 1152802014 17:82334905-82334927 CCCAGCCCCCGCCCTCGGGGAAA No data
Right 1152802022 17:82334920-82334942 CGGGGAAACCCCAGCCACCCTGG No data
1152802014_1152802034 18 Left 1152802014 17:82334905-82334927 CCCAGCCCCCGCCCTCGGGGAAA No data
Right 1152802034 17:82334946-82334968 CCAGTGAGATGCTGGAGAGGGGG No data
1152802014_1152802032 17 Left 1152802014 17:82334905-82334927 CCCAGCCCCCGCCCTCGGGGAAA No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802014_1152802030 15 Left 1152802014 17:82334905-82334927 CCCAGCCCCCGCCCTCGGGGAAA No data
Right 1152802030 17:82334943-82334965 CTGCCAGTGAGATGCTGGAGAGG No data
1152802014_1152802029 10 Left 1152802014 17:82334905-82334927 CCCAGCCCCCGCCCTCGGGGAAA No data
Right 1152802029 17:82334938-82334960 CCTGGCTGCCAGTGAGATGCTGG No data
1152802014_1152802031 16 Left 1152802014 17:82334905-82334927 CCCAGCCCCCGCCCTCGGGGAAA No data
Right 1152802031 17:82334944-82334966 TGCCAGTGAGATGCTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152802014 Original CRISPR TTTCCCCGAGGGCGGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr