ID: 1152802015

View in Genome Browser
Species Human (GRCh38)
Location 17:82334906-82334928
Sequence GTTTCCCCGAGGGCGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152802015_1152802022 -9 Left 1152802015 17:82334906-82334928 CCAGCCCCCGCCCTCGGGGAAAC No data
Right 1152802022 17:82334920-82334942 CGGGGAAACCCCAGCCACCCTGG No data
1152802015_1152802034 17 Left 1152802015 17:82334906-82334928 CCAGCCCCCGCCCTCGGGGAAAC No data
Right 1152802034 17:82334946-82334968 CCAGTGAGATGCTGGAGAGGGGG No data
1152802015_1152802029 9 Left 1152802015 17:82334906-82334928 CCAGCCCCCGCCCTCGGGGAAAC No data
Right 1152802029 17:82334938-82334960 CCTGGCTGCCAGTGAGATGCTGG No data
1152802015_1152802031 15 Left 1152802015 17:82334906-82334928 CCAGCCCCCGCCCTCGGGGAAAC No data
Right 1152802031 17:82334944-82334966 TGCCAGTGAGATGCTGGAGAGGG No data
1152802015_1152802032 16 Left 1152802015 17:82334906-82334928 CCAGCCCCCGCCCTCGGGGAAAC No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802015_1152802030 14 Left 1152802015 17:82334906-82334928 CCAGCCCCCGCCCTCGGGGAAAC No data
Right 1152802030 17:82334943-82334965 CTGCCAGTGAGATGCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152802015 Original CRISPR GTTTCCCCGAGGGCGGGGGC TGG (reversed) Intergenic