ID: 1152802018

View in Genome Browser
Species Human (GRCh38)
Location 17:82334912-82334934
Sequence GCTGGGGTTTCCCCGAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152802018_1152802029 3 Left 1152802018 17:82334912-82334934 CCCGCCCTCGGGGAAACCCCAGC No data
Right 1152802029 17:82334938-82334960 CCTGGCTGCCAGTGAGATGCTGG No data
1152802018_1152802031 9 Left 1152802018 17:82334912-82334934 CCCGCCCTCGGGGAAACCCCAGC No data
Right 1152802031 17:82334944-82334966 TGCCAGTGAGATGCTGGAGAGGG No data
1152802018_1152802034 11 Left 1152802018 17:82334912-82334934 CCCGCCCTCGGGGAAACCCCAGC No data
Right 1152802034 17:82334946-82334968 CCAGTGAGATGCTGGAGAGGGGG No data
1152802018_1152802032 10 Left 1152802018 17:82334912-82334934 CCCGCCCTCGGGGAAACCCCAGC No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802018_1152802030 8 Left 1152802018 17:82334912-82334934 CCCGCCCTCGGGGAAACCCCAGC No data
Right 1152802030 17:82334943-82334965 CTGCCAGTGAGATGCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152802018 Original CRISPR GCTGGGGTTTCCCCGAGGGC GGG (reversed) Intergenic
No off target data available for this crispr