ID: 1152802019

View in Genome Browser
Species Human (GRCh38)
Location 17:82334913-82334935
Sequence GGCTGGGGTTTCCCCGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152802019_1152802030 7 Left 1152802019 17:82334913-82334935 CCGCCCTCGGGGAAACCCCAGCC No data
Right 1152802030 17:82334943-82334965 CTGCCAGTGAGATGCTGGAGAGG No data
1152802019_1152802034 10 Left 1152802019 17:82334913-82334935 CCGCCCTCGGGGAAACCCCAGCC No data
Right 1152802034 17:82334946-82334968 CCAGTGAGATGCTGGAGAGGGGG No data
1152802019_1152802029 2 Left 1152802019 17:82334913-82334935 CCGCCCTCGGGGAAACCCCAGCC No data
Right 1152802029 17:82334938-82334960 CCTGGCTGCCAGTGAGATGCTGG No data
1152802019_1152802032 9 Left 1152802019 17:82334913-82334935 CCGCCCTCGGGGAAACCCCAGCC No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802019_1152802031 8 Left 1152802019 17:82334913-82334935 CCGCCCTCGGGGAAACCCCAGCC No data
Right 1152802031 17:82334944-82334966 TGCCAGTGAGATGCTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152802019 Original CRISPR GGCTGGGGTTTCCCCGAGGG CGG (reversed) Intergenic
No off target data available for this crispr