ID: 1152802022

View in Genome Browser
Species Human (GRCh38)
Location 17:82334920-82334942
Sequence CGGGGAAACCCCAGCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152802013_1152802022 -7 Left 1152802013 17:82334904-82334926 CCCCAGCCCCCGCCCTCGGGGAA No data
Right 1152802022 17:82334920-82334942 CGGGGAAACCCCAGCCACCCTGG No data
1152802014_1152802022 -8 Left 1152802014 17:82334905-82334927 CCCAGCCCCCGCCCTCGGGGAAA No data
Right 1152802022 17:82334920-82334942 CGGGGAAACCCCAGCCACCCTGG No data
1152802015_1152802022 -9 Left 1152802015 17:82334906-82334928 CCAGCCCCCGCCCTCGGGGAAAC No data
Right 1152802022 17:82334920-82334942 CGGGGAAACCCCAGCCACCCTGG No data
1152802009_1152802022 14 Left 1152802009 17:82334883-82334905 CCGGGGCACAGAGGTCAGATTCC No data
Right 1152802022 17:82334920-82334942 CGGGGAAACCCCAGCCACCCTGG No data
1152802008_1152802022 20 Left 1152802008 17:82334877-82334899 CCATGGCCGGGGCACAGAGGTCA No data
Right 1152802022 17:82334920-82334942 CGGGGAAACCCCAGCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152802022 Original CRISPR CGGGGAAACCCCAGCCACCC TGG Intergenic
No off target data available for this crispr