ID: 1152802028

View in Genome Browser
Species Human (GRCh38)
Location 17:82334938-82334960
Sequence CCAGCATCTCACTGGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152802028_1152802038 21 Left 1152802028 17:82334938-82334960 CCTGGCTGCCAGTGAGATGCTGG No data
Right 1152802038 17:82334982-82335004 TGCCCACGTCCTCTGCACAGAGG No data
1152802028_1152802041 23 Left 1152802028 17:82334938-82334960 CCTGGCTGCCAGTGAGATGCTGG No data
Right 1152802041 17:82334984-82335006 CCCACGTCCTCTGCACAGAGGGG No data
1152802028_1152802039 22 Left 1152802028 17:82334938-82334960 CCTGGCTGCCAGTGAGATGCTGG No data
Right 1152802039 17:82334983-82335005 GCCCACGTCCTCTGCACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152802028 Original CRISPR CCAGCATCTCACTGGCAGCC AGG (reversed) Intergenic
No off target data available for this crispr