ID: 1152802032

View in Genome Browser
Species Human (GRCh38)
Location 17:82334945-82334967
Sequence GCCAGTGAGATGCTGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152802018_1152802032 10 Left 1152802018 17:82334912-82334934 CCCGCCCTCGGGGAAACCCCAGC No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802025_1152802032 -8 Left 1152802025 17:82334930-82334952 CCAGCCACCCTGGCTGCCAGTGA No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802019_1152802032 9 Left 1152802019 17:82334913-82334935 CCGCCCTCGGGGAAACCCCAGCC No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802016_1152802032 12 Left 1152802016 17:82334910-82334932 CCCCCGCCCTCGGGGAAACCCCA No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802015_1152802032 16 Left 1152802015 17:82334906-82334928 CCAGCCCCCGCCCTCGGGGAAAC No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802020_1152802032 6 Left 1152802020 17:82334916-82334938 CCCTCGGGGAAACCCCAGCCACC No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802013_1152802032 18 Left 1152802013 17:82334904-82334926 CCCCAGCCCCCGCCCTCGGGGAA No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802017_1152802032 11 Left 1152802017 17:82334911-82334933 CCCCGCCCTCGGGGAAACCCCAG No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802023_1152802032 -6 Left 1152802023 17:82334928-82334950 CCCCAGCCACCCTGGCTGCCAGT No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802024_1152802032 -7 Left 1152802024 17:82334929-82334951 CCCAGCCACCCTGGCTGCCAGTG No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802014_1152802032 17 Left 1152802014 17:82334905-82334927 CCCAGCCCCCGCCCTCGGGGAAA No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data
1152802021_1152802032 5 Left 1152802021 17:82334917-82334939 CCTCGGGGAAACCCCAGCCACCC No data
Right 1152802032 17:82334945-82334967 GCCAGTGAGATGCTGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152802032 Original CRISPR GCCAGTGAGATGCTGGAGAG GGG Intergenic
No off target data available for this crispr