ID: 1152802033

View in Genome Browser
Species Human (GRCh38)
Location 17:82334946-82334968
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152802033_1152802044 28 Left 1152802033 17:82334946-82334968 CCAGTGAGATGCTGGAGAGGGGG No data
Right 1152802044 17:82334997-82335019 CACAGAGGGGCTTGTCCCCGAGG No data
1152802033_1152802038 13 Left 1152802033 17:82334946-82334968 CCAGTGAGATGCTGGAGAGGGGG No data
Right 1152802038 17:82334982-82335004 TGCCCACGTCCTCTGCACAGAGG No data
1152802033_1152802041 15 Left 1152802033 17:82334946-82334968 CCAGTGAGATGCTGGAGAGGGGG No data
Right 1152802041 17:82334984-82335006 CCCACGTCCTCTGCACAGAGGGG No data
1152802033_1152802039 14 Left 1152802033 17:82334946-82334968 CCAGTGAGATGCTGGAGAGGGGG No data
Right 1152802039 17:82334983-82335005 GCCCACGTCCTCTGCACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152802033 Original CRISPR CCCCCTCTCCAGCATCTCAC TGG (reversed) Intergenic
No off target data available for this crispr