ID: 1152802038

View in Genome Browser
Species Human (GRCh38)
Location 17:82334982-82335004
Sequence TGCCCACGTCCTCTGCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152802028_1152802038 21 Left 1152802028 17:82334938-82334960 CCTGGCTGCCAGTGAGATGCTGG No data
Right 1152802038 17:82334982-82335004 TGCCCACGTCCTCTGCACAGAGG No data
1152802033_1152802038 13 Left 1152802033 17:82334946-82334968 CCAGTGAGATGCTGGAGAGGGGG No data
Right 1152802038 17:82334982-82335004 TGCCCACGTCCTCTGCACAGAGG No data
1152802026_1152802038 25 Left 1152802026 17:82334934-82334956 CCACCCTGGCTGCCAGTGAGATG No data
Right 1152802038 17:82334982-82335004 TGCCCACGTCCTCTGCACAGAGG No data
1152802025_1152802038 29 Left 1152802025 17:82334930-82334952 CCAGCCACCCTGGCTGCCAGTGA No data
Right 1152802038 17:82334982-82335004 TGCCCACGTCCTCTGCACAGAGG No data
1152802024_1152802038 30 Left 1152802024 17:82334929-82334951 CCCAGCCACCCTGGCTGCCAGTG No data
Right 1152802038 17:82334982-82335004 TGCCCACGTCCTCTGCACAGAGG No data
1152802027_1152802038 22 Left 1152802027 17:82334937-82334959 CCCTGGCTGCCAGTGAGATGCTG No data
Right 1152802038 17:82334982-82335004 TGCCCACGTCCTCTGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152802038 Original CRISPR TGCCCACGTCCTCTGCACAG AGG Intergenic
No off target data available for this crispr