ID: 1152804098

View in Genome Browser
Species Human (GRCh38)
Location 17:82346890-82346912
Sequence CTCCCCAGGAGGGCTCCGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152804089_1152804098 -6 Left 1152804089 17:82346873-82346895 CCAAGGAGCGGCTTCCCCTCCCC No data
Right 1152804098 17:82346890-82346912 CTCCCCAGGAGGGCTCCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152804098 Original CRISPR CTCCCCAGGAGGGCTCCGAG GGG Intergenic
No off target data available for this crispr