ID: 1152807427

View in Genome Browser
Species Human (GRCh38)
Location 17:82362795-82362817
Sequence ACAGAAGATGACCCCAGACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152807420_1152807427 22 Left 1152807420 17:82362750-82362772 CCTGCAGCTTGTCTCCATGGTGG 0: 1
1: 0
2: 1
3: 9
4: 196
Right 1152807427 17:82362795-82362817 ACAGAAGATGACCCCAGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 247
1152807423_1152807427 8 Left 1152807423 17:82362764-82362786 CCATGGTGGGCTGCTATGATACC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1152807427 17:82362795-82362817 ACAGAAGATGACCCCAGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 247
1152807419_1152807427 23 Left 1152807419 17:82362749-82362771 CCCTGCAGCTTGTCTCCATGGTG 0: 1
1: 0
2: 2
3: 11
4: 170
Right 1152807427 17:82362795-82362817 ACAGAAGATGACCCCAGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152807427 Original CRISPR ACAGAAGATGACCCCAGACA GGG Exonic
901827254 1:11870269-11870291 ACAGAAGCTCCCCCAAGACAGGG - Intergenic
902234644 1:15049498-15049520 ACAGCAGTAGACTCCAGACATGG + Intronic
902520961 1:17016142-17016164 ACAGAAGCTATCCACAGACATGG + Intergenic
904332776 1:29773805-29773827 ACAGAAAAGGACACCAGAAATGG - Intergenic
910195392 1:84634766-84634788 ACAGAAGTTCACCCAAGACTTGG + Intronic
912735566 1:112146808-112146830 ACAGATGTTTACCTCAGACAGGG + Intergenic
913538843 1:119799709-119799731 ACAGAAGGTAACCTCAGACTTGG - Exonic
914353943 1:146865529-146865551 ACAAATGCTGACCCCAGACAAGG + Intergenic
914822241 1:151113514-151113536 ACAGAAGATTTGGCCAGACACGG - Intronic
916167504 1:161977125-161977147 ACTTAAGATGACCCCATTCATGG - Intergenic
917825939 1:178820389-178820411 CCAGAAGATGAAACCAGAAAGGG - Intronic
918311364 1:183287811-183287833 CCAGAAGATCACCCCAGCCTTGG - Intronic
918928636 1:190823131-190823153 AAAGATCATGAGCCCAGACATGG + Intergenic
919730109 1:200908423-200908445 ACAAAAGATAACTGCAGACATGG + Intronic
919932632 1:202231200-202231222 ACTGAAGATGGCTCCATACAGGG - Intronic
919979239 1:202632092-202632114 ACAGAAGGTGGCACCAGAGAAGG + Intronic
920254748 1:204646936-204646958 AGACAAGATGAGCCCAGCCATGG + Intronic
921665875 1:217869966-217869988 AAAGAAGATGAACCAAGACTTGG + Exonic
922549290 1:226482332-226482354 ACAGAAGCTGCCCCCAGAGCAGG + Intergenic
922786528 1:228285449-228285471 AAAGAAGCTGACCCCAGCCCGGG - Intronic
923077636 1:230624207-230624229 ACACAAGATGGCACCAGCCACGG + Intergenic
1062864577 10:840859-840881 ACATAAGATGAGGCCAGGCATGG + Intronic
1066434945 10:35388914-35388936 ACAGAAGTACACTCCAGACATGG - Intronic
1068237583 10:54259295-54259317 ACCTAAGGTGACCCCAGACAGGG - Intronic
1068985431 10:63103937-63103959 ACAGAAGATGCCTCCAGCGAGGG + Intergenic
1069846959 10:71378909-71378931 CTAGAAGCTGATCCCAGACAAGG - Intergenic
1070950243 10:80425439-80425461 ACAGAAAATGTCACCAAACAGGG + Intronic
1072945041 10:99802399-99802421 CCAGGAGTTGTCCCCAGACAAGG + Intronic
1074481620 10:113827013-113827035 ACAGAAGATGGCTCTTGACATGG - Intergenic
1074919377 10:117991983-117992005 ACAGGTGATGACACCAGACATGG + Intergenic
1077753670 11:5002596-5002618 TCAGTGGATGACCCCAGGCAAGG - Intergenic
1078714490 11:13826928-13826950 ACAGAAAATGACAGCAGAAACGG + Intergenic
1079828883 11:25235628-25235650 TCAGAGGATGGCTCCAGACAAGG - Intergenic
1080658164 11:34274309-34274331 ACAGAAGATGACAGAAGCCAAGG + Intronic
1080679132 11:34457494-34457516 ACAGAAAATGAGGCCAGCCACGG - Intronic
1081601057 11:44494592-44494614 ACTGAATATGACCCCACTCAGGG + Intergenic
1084146836 11:67269522-67269544 ACAGCCGATGGCCCCAGACAAGG - Intronic
1084694601 11:70746065-70746087 ACAGGTGCTGACCCGAGACAGGG + Intronic
1084696351 11:70757855-70757877 ACAACAAATGACCCCAGACCAGG + Intronic
1089401932 11:118169313-118169335 CCAGCAGAAGACCACAGACAAGG + Intronic
1090463909 11:126916164-126916186 AAAGCAGATGAGCCCAGATATGG + Intronic
1090643721 11:128750363-128750385 ACACAGAATGACCCAAGACATGG - Intronic
1092530749 12:9342748-9342770 GGAGAAGATGACTCCACACATGG - Intergenic
1094080880 12:26533932-26533954 ACAGAAGATGATACAATACAAGG + Intronic
1096875010 12:54622048-54622070 ACATAAGATGAACCCAAACTGGG - Intergenic
1103979337 12:124726451-124726473 ACAGAAGATGCCAGCACACAGGG - Intergenic
1104540386 12:129658916-129658938 ACAGAGTGAGACCCCAGACAGGG - Intronic
1105227669 13:18451495-18451517 ACAGAAGATGGCCACACCCAAGG + Intergenic
1106310881 13:28553276-28553298 AGAGAAGAGGAACCCAGACGCGG + Intergenic
1112600263 13:100848323-100848345 AAAGTAGATGTCCCCTGACAAGG + Intergenic
1115894633 14:38072456-38072478 AAAGAACATGAGCCCAGACGTGG + Intergenic
1116282715 14:42928987-42929009 ACAGAAGAGGTCAGCAGACAGGG + Intergenic
1116869024 14:50054341-50054363 ACAGAAGGTCCCCCCAGACTAGG - Intergenic
1116873842 14:50092237-50092259 ACAGAAGGTGACTCAAGACAAGG - Intronic
1117214940 14:53541311-53541333 ACAGAAGATGATACAAGAGATGG + Intergenic
1117651861 14:57915816-57915838 TCAGAAGAAGACCCCAGAACTGG - Intronic
1117745948 14:58869688-58869710 AAGGAAGAGGACCCCAGGCAGGG - Intergenic
1117832058 14:59761599-59761621 ACTGAAGAAGACCCTAGAAAGGG + Intronic
1117912948 14:60651860-60651882 ACAGAGGATGACAGCAGAGATGG + Intronic
1118052319 14:62042817-62042839 AGAGAAGAGGACTCAAGACAAGG - Intronic
1118850577 14:69580248-69580270 ACAGCACATCACCCCAGAGAAGG - Intergenic
1119733277 14:76964756-76964778 ACAGAGAATGACCCCAGCAAAGG + Intergenic
1123018470 14:105386624-105386646 ACAGCAAATGACCTCACACAGGG - Intronic
1125161857 15:36653483-36653505 ACAAAACAAAACCCCAGACATGG - Intronic
1126338769 15:47616590-47616612 AAAAAAGATGATCCTAGACAAGG + Intronic
1127356413 15:58205078-58205100 GCAGAAGAGCACCCCAGTCATGG - Intronic
1127434990 15:58948650-58948672 AGAGCAAATGACCCAAGACAGGG - Intronic
1127465451 15:59240187-59240209 TCAGAAGACGGGCCCAGACATGG - Intronic
1128664730 15:69529818-69529840 TGAGAATATGTCCCCAGACAGGG + Intergenic
1130112543 15:80977645-80977667 ACAGAAAAAGCCCACAGACAGGG + Exonic
1130144483 15:81263529-81263551 ACAGAAATCGACCCCAGACCAGG + Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1132302464 15:100784454-100784476 AAAGAAGCTGTCCCCAAACATGG + Intergenic
1134063472 16:11212511-11212533 CTAGAAGCTGACCCTAGACAGGG - Intergenic
1134205301 16:12232758-12232780 GCAGAAGATGTCCCCTGAGAGGG + Intronic
1135355641 16:21766927-21766949 AGAGAAGATGACCACACACCTGG - Intergenic
1135454130 16:22583072-22583094 AAAGAAGATGACCACACACCTGG - Intergenic
1135617629 16:23925570-23925592 AGACAGGATGACCTCAGACAGGG - Intronic
1136181888 16:28558614-28558636 AAAGAAGATAGCCCCAGAGAAGG + Intronic
1139980078 16:70849990-70850012 ACAAATGCTGACCCCAGACAAGG - Intronic
1141707124 16:85672422-85672444 ACAGAAGATGGTCTCAGAAAGGG + Exonic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141764214 16:86048006-86048028 ACAGAAGATGACCTCCTGCACGG + Intergenic
1143370958 17:6439070-6439092 ACAGAAAATGAACTAAGACAGGG - Intergenic
1143991563 17:10967944-10967966 ACATAATATGACCACAGAAAGGG - Intergenic
1146455975 17:33009968-33009990 ATGGCACATGACCCCAGACACGG - Intergenic
1148901231 17:50879250-50879272 ACAGAAGATAAAACCAGGCACGG + Intergenic
1149980012 17:61303241-61303263 TCAGAAGATGCCCACAGACTGGG - Intronic
1151165046 17:72196272-72196294 ACACAAGTTTCCCCCAGACATGG - Intergenic
1151384190 17:73745199-73745221 CCAGAAGCAGACCCAAGACAAGG + Intergenic
1152430666 17:80246796-80246818 CCAGGAGATGGCCCCAGAGATGG + Intronic
1152807427 17:82362795-82362817 ACAGAAGATGACCCCAGACAGGG + Exonic
1153185567 18:2482225-2482247 ACAAAAAATTACCCCAGGCATGG + Intergenic
1153230457 18:2930542-2930564 ACAAAAGATGACACTAGTCACGG + Intronic
1153925705 18:9833089-9833111 CAAGAAGATGACCCAAGACCTGG + Intronic
1154306986 18:13237879-13237901 ACAGCATGTGACCTCAGACAAGG - Intronic
1154525713 18:15287981-15288003 ACAGAAGATGGCCACACCCAAGG - Intergenic
1156396165 18:36701900-36701922 ACTGAAGATGACTTCAGAGATGG - Intronic
1157533992 18:48445045-48445067 ACAGAAGAAGACATCAAACAGGG - Intergenic
1159332400 18:67014417-67014439 TCAGCAGATGACACCAGACAAGG + Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161340077 19:3736557-3736579 ACAAAAAATGAACCCAGATAAGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1163398742 19:17079082-17079104 ACTGAAAATGACTCCAGCCATGG + Intronic
1163431897 19:17273203-17273225 GCAGCACATGACTCCAGACAAGG - Intronic
1163994839 19:21034325-21034347 ACAGAAGATGACCCTATGCGAGG - Intronic
1164706190 19:30322062-30322084 AGGGAAGATGAGGCCAGACATGG - Intronic
1165066830 19:33234422-33234444 AAAGAAGAGGATCCGAGACAGGG - Intergenic
1167738927 19:51312329-51312351 ACAGATGAAGACCCCTAACAGGG - Intronic
925474409 2:4196919-4196941 AGAGGAGATGACCCCTGCCATGG - Intergenic
926626653 2:15096071-15096093 AAAGAATAGGACCCAAGACATGG - Intergenic
928870634 2:35973728-35973750 CCAGAAGCAGACCCCAGGCAGGG + Intergenic
929396620 2:41531162-41531184 AAAGAAGAATACCCCTGACAGGG + Intergenic
930873674 2:56191102-56191124 AGTGAAGATGATCCCAGGCAGGG - Intronic
931286182 2:60833824-60833846 ATAGACGCTGACCCCAGACTTGG - Intergenic
932053698 2:68423610-68423632 TCAGAAGGTGACTCCAGAGATGG + Intergenic
932146425 2:69322822-69322844 ACACAATATGCCCCCAAACATGG + Exonic
932573694 2:72951314-72951336 CCAGGAGATATCCCCAGACATGG + Intronic
933688689 2:85162634-85162656 ACCGAAGGTGACCCCAGAGATGG - Intronic
937237959 2:120442021-120442043 ACAGCTGCTGGCCCCAGACAAGG - Intergenic
937486011 2:122315538-122315560 ACTGAAGACAACCTCAGACAGGG - Intergenic
941619471 2:167759790-167759812 ACAGTAGCTTACCACAGACATGG - Intergenic
946030321 2:216698561-216698583 ACAGGAAATGACCACAGGCAAGG - Intergenic
947416493 2:229901832-229901854 ACAGAAGATGGTAGCAGACAGGG + Intronic
948118418 2:235511052-235511074 ACCGAAAATTGCCCCAGACATGG - Intronic
1169509273 20:6245927-6245949 CCACAAGATCACCCCAGCCATGG + Intergenic
1171486892 20:25491715-25491737 GCTGGAGGTGACCCCAGACAAGG + Intronic
1172520151 20:35560822-35560844 ACAGCAGATGGCCCCAGGAATGG + Intergenic
1172968484 20:38856292-38856314 ACAGAAGACAGCCCCAGACCTGG + Intronic
1173849008 20:46206111-46206133 AGAGATGATGGCCTCAGACATGG - Intronic
1174190081 20:48734420-48734442 GCAGGAGATTACCCCAGCCAAGG + Intronic
1174401038 20:50276100-50276122 CCAGAAGCTGACCCAAGACAAGG - Intergenic
1175434087 20:58930299-58930321 AAAGAAGACGACTCCAGAGAGGG + Intergenic
1176771712 21:13080506-13080528 ACAGAAGATGGCCACACCCAAGG + Intergenic
1178373319 21:32046043-32046065 CAAGAAGATGACCCAAGACATGG + Intergenic
1180073858 21:45451859-45451881 ACTGGAGATGACCCCAGCCAAGG - Intronic
1180107917 21:45631950-45631972 ACAAAAGAGGGCCCCACACATGG - Intergenic
1183082040 22:35462947-35462969 ACAGAAGCTGAAGGCAGACAGGG - Intergenic
1183156800 22:36081978-36082000 ACAGAGACTGACCACAGACACGG - Intergenic
1184557687 22:45241787-45241809 GGAGAAGAGGACTCCAGACAGGG - Intergenic
1185389458 22:50550944-50550966 ACAGAAAAAGGGCCCAGACAGGG - Exonic
949962145 3:9321253-9321275 AGTGAACATGACCCCAGGCATGG + Intronic
950240028 3:11360943-11360965 ACAGTTGATGACGCCAGTCAAGG - Intronic
950872808 3:16243911-16243933 ACAGAACACGACATCAGACAAGG - Intergenic
951100085 3:18677342-18677364 AGAGAAGATGACCACAGATCAGG - Intergenic
951632859 3:24740193-24740215 ACAGAAGATGAGCTCTGCCAGGG + Intergenic
951954797 3:28241963-28241985 TGAGAAGATGACCTCAGACCGGG - Intronic
954219275 3:49142919-49142941 ACAGAAGATGGCCACACCCAAGG + Intergenic
954495665 3:50958221-50958243 GCAGAAGACAACCCCAGTCAAGG - Intronic
955188407 3:56737077-56737099 AAAGAACATGACCCTAGATAGGG + Intronic
956287075 3:67621869-67621891 ACAGAAAATGAACTAAGACATGG + Intronic
956669477 3:71672834-71672856 ACAAAAGAGGGCCCCAGCCAGGG - Intergenic
956727258 3:72166428-72166450 ACAGAAGCTGAGGCCAGGCATGG + Intergenic
957306842 3:78468018-78468040 ACAGAGGATGAGCCAAAACATGG - Intergenic
958185817 3:90117995-90118017 AGACAAGGTGACCCAAGACAAGG - Intergenic
958185820 3:90118010-90118032 ACTCAAGGTGACCCAAGACAAGG - Intergenic
959020410 3:101182374-101182396 AAATAAGATGAGGCCAGACATGG + Intergenic
959938984 3:112060435-112060457 ATAGAAGATGACCACACCCAAGG + Intronic
961835069 3:129651066-129651088 AGAGGTGATGAGCCCAGACAAGG + Exonic
962048145 3:131783327-131783349 ACAGAAGGGGAGCTCAGACATGG - Intronic
963659359 3:148104544-148104566 ACAGAAGATGAAGCCAGAGAAGG + Intergenic
964361008 3:155896297-155896319 ACAGAAGCTAACGCCAGGCATGG - Intronic
965949685 3:174292824-174292846 ACACAAGATTACCTCAGAAAAGG + Intergenic
966825271 3:183959784-183959806 ACAGAAGAAGTCACAAGACAAGG - Exonic
968212170 3:196857986-196858008 ACAGAAGATGGCCACACCCAAGG + Intergenic
968867297 4:3221457-3221479 AAAGAAAATGAGCACAGACAAGG - Intronic
968972697 4:3804154-3804176 ACAGAAGCGGACCTGAGACAAGG - Intergenic
972186822 4:36538798-36538820 ATAGAAGATGACCCCAGAATGGG - Intergenic
973101159 4:46272801-46272823 AAAGAAGATGAGGCCAGAAAAGG + Intronic
974827310 4:67147994-67148016 ACAGCAGCTGTCCCCAGGCAAGG - Intergenic
975721204 4:77250269-77250291 ACAAAAGATGACCCAAGTGAGGG + Intronic
979025619 4:115570650-115570672 GCAGAAGATGAGCTCAGAGAGGG + Intergenic
979797881 4:124869928-124869950 ACAGAAGATATCCCATGACAAGG + Intergenic
980952050 4:139390336-139390358 ACATAAAATGAACCCAGTCAAGG - Exonic
980989705 4:139728741-139728763 CAAGATGATGCCCCCAGACAAGG - Intronic
981312890 4:143314085-143314107 ACAGAAGTTTCCCCCAGACTGGG + Intergenic
981911604 4:149987791-149987813 AGAGAAGGTGAACCCAGGCATGG + Intergenic
982371620 4:154639523-154639545 GCAGCAGATGACAGCAGACAAGG + Intronic
986067842 5:4253182-4253204 ATAGAAGATGATCCAAGAGAGGG - Intergenic
989455047 5:41634544-41634566 ACAGAAGATGGCCACACCCAAGG - Intergenic
991114824 5:62942610-62942632 ACTGAAGAGGACCCAATACACGG + Intergenic
992442138 5:76806092-76806114 ACATAAGATAACCTCTGACAAGG - Intergenic
992664780 5:78996652-78996674 ACAGAGGAGGAACCCAGAGATGG + Intergenic
993188016 5:84645453-84645475 TCAGAAAATCACCCCAGGCAAGG - Intergenic
994602858 5:101928831-101928853 TCAGATGTTGACCTCAGACAAGG - Intergenic
995119999 5:108526065-108526087 ACAGAAGACGACCACACTCAAGG - Intergenic
996075012 5:119181933-119181955 ACAGAAAATCAACCAAGACAAGG + Intronic
997049960 5:130368282-130368304 ACTGAAGATGAATCCAGAAAAGG - Intergenic
997688171 5:135804145-135804167 ACAGAAGGTGTCCACAGACAGGG + Intergenic
997689077 5:135813397-135813419 CCAGAAGTGGACCCCAGAGAAGG + Intergenic
998366335 5:141634966-141634988 ACACAAGATGAACCCAGGCAGGG + Intronic
1001066509 5:168539007-168539029 ACAGAAGTTGATACCAGAGATGG - Intergenic
1001342920 5:170863290-170863312 GCAGGAGATGACCCCAGGGAGGG + Intronic
1001399787 5:171439623-171439645 AAAGAAGCTAAGCCCAGACATGG - Intronic
1001614951 5:173035764-173035786 AAGGAAGCTGAGCCCAGACAGGG + Intergenic
1003980635 6:11386869-11386891 CCTGACAATGACCCCAGACACGG + Intergenic
1005254649 6:23988269-23988291 ACAGAGACTGACCACAGACATGG + Intergenic
1006966463 6:37990924-37990946 ACAAAGAATGACCCCAGGCATGG + Intronic
1007717264 6:43864530-43864552 ACAGAAAATGACCCCTGATGAGG + Intergenic
1010825379 6:80466878-80466900 TCTGAAGCTGACCCCAGATAGGG - Intergenic
1011564989 6:88664711-88664733 AGAGCAAAAGACCCCAGACAAGG + Intronic
1011878458 6:91992347-91992369 ACAGAAGATGGCCACATCCAAGG + Intergenic
1013296015 6:108759068-108759090 ACACAAAATGACCTCAGATAAGG - Intergenic
1015628360 6:135205124-135205146 ACATAAGAGGAACCCAGAAAGGG + Intronic
1016255572 6:142101350-142101372 TCAGAGGATGACCCAAAACAGGG - Intergenic
1016443374 6:144107813-144107835 AGAGAAAAAGACCCAAGACAAGG + Intergenic
1016731738 6:147434937-147434959 AAAGAAAAAGACCTCAGACATGG + Intergenic
1018630938 6:165821988-165822010 AAACAAGATGACCTCAGAAAGGG + Intronic
1019335264 7:479821-479843 ACAGAAGGCGACCCCAGAGCCGG + Intergenic
1019617672 7:1973588-1973610 ACACACGAGGACCACAGACAGGG + Intronic
1021898167 7:25257099-25257121 ACAGAGGATGAGCCCAGGCAGGG + Intergenic
1022276748 7:28862756-28862778 ACAGAAGAGGTCCCAAGACTGGG + Intergenic
1030601412 7:111597205-111597227 ACAGAAGATGGCCACACCCAAGG - Intergenic
1031725672 7:125235127-125235149 AGAGAAGATGCCAACAGACATGG + Intergenic
1031915186 7:127556266-127556288 ACTGACTCTGACCCCAGACAAGG - Intergenic
1033160460 7:138991671-138991693 ACAGAATGTGACCTCAGACAAGG + Intergenic
1034830762 7:154305488-154305510 ACAGACCATGACCACAGCCAAGG + Exonic
1035448406 7:158958386-158958408 ACAGAACAGGACCCCGGCCACGG - Intergenic
1035705944 8:1675090-1675112 GCAGAAGCTGACCCTAGACTGGG - Intronic
1036667319 8:10755796-10755818 CCAGAAGAAGACCCCAGCCCAGG + Intronic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1038786577 8:30622674-30622696 ATAGAAGATGGCCACAGCCAGGG + Intronic
1040124850 8:43725809-43725831 ACAGAAGATGGCCACACCCAAGG - Intergenic
1040819707 8:51542237-51542259 ACAGAACACAACCTCAGACAAGG + Intronic
1041188973 8:55333731-55333753 TCTGAAGATGTCCCCAGACAAGG + Intronic
1041358846 8:57029206-57029228 ACAGAAAATGAACTAAGACATGG + Intergenic
1041480062 8:58310165-58310187 ACAGAACATCACATCAGACAAGG + Intergenic
1042030622 8:64471887-64471909 CCAGAAGCAGACCCAAGACAAGG + Intergenic
1042606644 8:70552913-70552935 AGAAAAGAGGACCCCAGACAGGG - Intergenic
1042717957 8:71795475-71795497 ACAGGATATGACCCTAGACTGGG - Intergenic
1043808306 8:84701848-84701870 ACAGGAGATGACACCCCACAAGG - Intronic
1046129583 8:109950190-109950212 ACAGAATTTGAGCCCAGAAATGG - Intergenic
1047968058 8:130061654-130061676 ACAGAGGTTAACCCGAGACAGGG - Intronic
1048519737 8:135142338-135142360 AAAGAAAATCACCCCAGTCATGG + Intergenic
1048621007 8:136133075-136133097 ATGGAAAATGACCCCAAACAAGG - Intergenic
1048775054 8:137936312-137936334 ACAGCACATGACTGCAGACAGGG + Intergenic
1048855019 8:138679465-138679487 ATGGAAGAAGATCCCAGACAAGG - Intronic
1049538634 8:143194922-143194944 AGTGAAGATGACCCCAGCCCAGG + Intergenic
1051878150 9:21812234-21812256 ACAGATGGTGACCCCACTCATGG + Intronic
1052798030 9:32942010-32942032 ACACAAGATGTCCCTGGACAGGG + Intergenic
1053082326 9:35186792-35186814 AGACAAGATGGCACCAGACAAGG - Intronic
1053148044 9:35725276-35725298 TCAGATGATGACCCCAAAAAGGG - Exonic
1053185068 9:36009115-36009137 ACAGAATGTGACCCAGGACAGGG - Intergenic
1054814831 9:69465176-69465198 CCAGAAAATGCCCCCAGTCATGG + Intronic
1056663373 9:88560992-88561014 ACACAAGAAGACCCCACACATGG + Intronic
1057249156 9:93485686-93485708 AGAGAAGTTGACCCTGGACAAGG - Intronic
1057306318 9:93914211-93914233 TGAGAAGGTCACCCCAGACAGGG + Intergenic
1057469198 9:95342731-95342753 AGAGAGGGTGACCCCAGACTGGG + Intergenic
1058784016 9:108367972-108367994 ACAGCATTTTACCCCAGACAAGG - Intergenic
1059940749 9:119357119-119357141 AAAGAACATGAGCCCAGATATGG - Intronic
1062336787 9:136074766-136074788 ACAGAATGTGACCACCGACATGG - Intronic
1062686415 9:137815690-137815712 ACAGAAGCTGGCCCCAGGCTGGG + Intronic
1203791933 EBV:156268-156290 ATAGAAGAGTCCCCCAGACATGG + Intergenic
1186580339 X:10810905-10810927 ACAGAGGAGCACCACAGACAGGG - Intronic
1187204460 X:17169120-17169142 TCAGTAGCTGACCACAGACATGG + Intergenic
1187821890 X:23296695-23296717 TGAGCAGATGACCCCAGATAGGG - Intergenic
1188443622 X:30234831-30234853 TCAGAACAAGACCCTAGACAGGG - Intronic
1188818052 X:34739564-34739586 ACAGAAGAGGACACAAGGCAGGG + Intergenic
1190310185 X:49111816-49111838 ACAGAAGCAGACCCCTGCCAGGG + Intergenic
1192074572 X:67979797-67979819 ACAGAAAACAACCTCAGACAAGG + Intergenic
1192206941 X:69102613-69102635 ACAGAAGATGAGCTCACGCACGG - Intergenic
1192341954 X:70270022-70270044 ACAGAGGATGATCCCTGAAATGG - Intronic
1194662463 X:96642101-96642123 ACAGAGGGTGACCCCAAACCTGG - Intergenic
1195776552 X:108412529-108412551 ACAGAAAATGGCCCCTGAAATGG - Intronic
1196036723 X:111153443-111153465 ACAGAAAATGATCTCAGATAAGG + Intronic
1199976458 X:152897614-152897636 ACAGATGGAGATCCCAGACAGGG - Intergenic