ID: 1152809544

View in Genome Browser
Species Human (GRCh38)
Location 17:82375071-82375093
Sequence GCGCGCGCGCCCCCGGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 440}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152809544_1152809548 -7 Left 1152809544 17:82375071-82375093 CCGGCGGCCGGGGGCGCGCGCGC 0: 1
1: 0
2: 6
3: 57
4: 440
Right 1152809548 17:82375087-82375109 CGCGCGCTGCGCCTGGTGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 129
1152809544_1152809550 12 Left 1152809544 17:82375071-82375093 CCGGCGGCCGGGGGCGCGCGCGC 0: 1
1: 0
2: 6
3: 57
4: 440
Right 1152809550 17:82375106-82375128 TGGGCATCGTGCTGCTCTTCTGG 0: 1
1: 0
2: 3
3: 12
4: 123
1152809544_1152809547 -8 Left 1152809544 17:82375071-82375093 CCGGCGGCCGGGGGCGCGCGCGC 0: 1
1: 0
2: 6
3: 57
4: 440
Right 1152809547 17:82375086-82375108 GCGCGCGCTGCGCCTGGTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 153
1152809544_1152809551 13 Left 1152809544 17:82375071-82375093 CCGGCGGCCGGGGGCGCGCGCGC 0: 1
1: 0
2: 6
3: 57
4: 440
Right 1152809551 17:82375107-82375129 GGGCATCGTGCTGCTCTTCTGGG 0: 1
1: 0
2: 1
3: 22
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152809544 Original CRISPR GCGCGCGCGCCCCCGGCCGC CGG (reversed) Exonic
900096644 1:942601-942623 GAGCGCGCGCCCACAGCTGCTGG + Exonic
900314752 1:2051128-2051150 GCGCCCGCGCCCCGGGTCTCCGG - Intronic
900349558 1:2228181-2228203 TCGCGCCCGCCGCCGGCCCCCGG - Intergenic
900512623 1:3067791-3067813 GCGGGCGCGACCCCTGCCTCGGG + Intergenic
900786749 1:4654578-4654600 GCGCGCTCGCCCCCGCCTCCCGG - Intergenic
901086732 1:6615195-6615217 TCCCGCGCGCCCCCGGCCCGAGG + Intronic
901381602 1:8878390-8878412 GCGCCCCCGCCCCGGGCCTCGGG + Intronic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
902286106 1:15409776-15409798 GCGTGATCGCTCCCGGCCGCCGG - Intergenic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
903034180 1:20484244-20484266 GCGCGCCCTCTCCCAGCCGCTGG + Intronic
903389480 1:22953857-22953879 GTGCGCGCGCGCCTGGCCGCGGG - Exonic
904001581 1:27341937-27341959 GGGGGCGCACCCCCGGGCGCTGG + Intergenic
904237096 1:29122984-29123006 GCCCAGGCGCCCCAGGCCGCAGG + Intronic
904682735 1:32240479-32240501 GGGCGCGCTCCCTCTGCCGCTGG + Intergenic
904769030 1:32870803-32870825 GCGCGAGCGCGAGCGGCCGCCGG - Exonic
905037878 1:34929487-34929509 GCGCCCCCGGCCCGGGCCGCCGG - Exonic
905137025 1:35808056-35808078 GCGTGCGCGGCCCCGGGCGCGGG - Intergenic
905221461 1:36450697-36450719 GCGCTTGGGACCCCGGCCGCTGG + Intergenic
905819855 1:40980417-40980439 GCGCCCCGACCCCCGGCCGCCGG - Intronic
907278138 1:53328113-53328135 GGGCGCGCGGCCCCGGCCCTGGG + Intergenic
907341567 1:53739222-53739244 GCGGGCCCGCCCCCGTCCCCCGG - Intergenic
908354574 1:63317583-63317605 GGGCGCGCGCCCCTCTCCGCCGG - Intergenic
908796128 1:67833058-67833080 GCGCGCGCGCCCTCGACGGGCGG - Intronic
909475220 1:76074634-76074656 GCCCGCGCGGCCCCGCCCCCGGG - Intergenic
911072896 1:93846628-93846650 GCGCGCTCGAGCGCGGCCGCGGG - Intronic
911348139 1:96721684-96721706 GCGCGCCGGCGCCCGGCAGCGGG - Intronic
912401602 1:109397931-109397953 GCGCGCCCGCCCACCCCCGCCGG + Exonic
912716873 1:111989527-111989549 GCGCGCGGGGCGCCGGGCGCGGG - Intergenic
913027123 1:114854853-114854875 GCGCGTGGGCCCCGGGCGGCTGG - Exonic
913658391 1:120983392-120983414 GCGGTCGCGGCCCCCGCCGCAGG + Intergenic
914009759 1:143766501-143766523 GCGGTCGCGGCCCCCGCCGCAGG + Intergenic
914648377 1:149675162-149675184 GCGGTCGCGGCCCCCGCCGCAGG + Intergenic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
914869153 1:151458902-151458924 GTGCGTGCGCCCCGGGCCGCGGG - Intronic
914889704 1:151612083-151612105 GCGCCCGATCCGCCGGCCGCGGG - Exonic
916694597 1:167221894-167221916 GCCCGCGCGCCCCCGGCCGGCGG + Intronic
917846725 1:179026122-179026144 GGGCGCGCGACCCCCGCCCCCGG + Intronic
918332503 1:183472910-183472932 GCGCGCGCGCCCTTGGTCTCGGG + Intronic
918601977 1:186375145-186375167 GCTCGCGCGCGCCCGCCCGCCGG + Exonic
921039469 1:211416452-211416474 GCGCGGGCTCCCCCTGCCTCCGG + Intergenic
922539452 1:226408004-226408026 GCGTGCGCTCACCCAGCCGCAGG + Exonic
922739419 1:228007004-228007026 ACCCGCGCACCCGCGGCCGCAGG + Intergenic
922925409 1:229343088-229343110 CCACGCGCGCTCCCGGCCCCCGG + Intronic
924090105 1:240492923-240492945 CCCCGCGCGCGCCCGGCCGCTGG - Exonic
924188212 1:241519240-241519262 GCGCGCAGGCCCCCAGCCCCGGG - Intronic
1063407694 10:5813027-5813049 GCCCGCTCGCCCCGGGACGCGGG + Intronic
1065099906 10:22321894-22321916 GGGCGCGCGCTCGCGGGCGCGGG - Intronic
1065390154 10:25174917-25174939 GGGCGCGCGCCCCGCGCCTCCGG + Intergenic
1065549920 10:26860415-26860437 GGGCGCGCGACCCCGGTGGCCGG + Intronic
1065637536 10:27745979-27746001 GTCCGCGCCCGCCCGGCCGCGGG + Exonic
1067112348 10:43409213-43409235 GCGGCCCCGCCCCCGGACGCCGG - Intergenic
1069024045 10:63521334-63521356 CCCCGCCCGCCCCCGCCCGCCGG - Intergenic
1069386032 10:67884467-67884489 GCGCACTCGGCCCCGGCGGCCGG - Intergenic
1069695550 10:70382789-70382811 GCCCGCGCGCTCCCGGCCGCAGG + Intergenic
1070305317 10:75235795-75235817 GCGCCCGCCCACCCGCCCGCCGG + Intronic
1072089639 10:92115043-92115065 TCCCCCGCGCCCGCGGCCGCCGG - Intronic
1073147952 10:101292610-101292632 GCGGGCGCGGGCGCGGCCGCGGG - Intergenic
1073520282 10:104122007-104122029 GCGCGCGCGCCTCCGCCAGCGGG - Intergenic
1074843191 10:117375106-117375128 GCGCGGGCGGCCTCGTCCGCCGG + Exonic
1075129559 10:119726295-119726317 GCGCGCGCTCGCCCTGCTGCAGG - Exonic
1075501692 10:122980580-122980602 TCGCGCGCGCCCTCGCCCACCGG + Exonic
1076117062 10:127907801-127907823 GCGGGCGCCCGCCCGGCTGCGGG - Intronic
1076157027 10:128212089-128212111 GGGCGCGCGTCTGCGGCCGCGGG + Intergenic
1076878757 10:133230122-133230144 GCGCGCCCCGCCCCGCCCGCCGG - Intergenic
1076879070 10:133231126-133231148 GCGCGCCCGTCCGCGGCCCCGGG + Exonic
1076935475 10:133565776-133565798 GCGCGGGGGCACCCGGCAGCGGG - Intronic
1077074940 11:696052-696074 GCGCGCGGGCGCCTGGCCCCGGG + Intronic
1077102888 11:830022-830044 GCGCGAGCGCCCCGAGCTGCTGG + Exonic
1077360792 11:2139431-2139453 CCGCGCGGGCCCTGGGCCGCGGG - Intronic
1077413649 11:2414684-2414706 GCGGGCCCGGCCCCAGCCGCCGG + Intronic
1078246212 11:9574521-9574543 GGGCGCGGGCACCCGGCGGCCGG + Intronic
1078317035 11:10302920-10302942 CCGCGCGCGCCTCCGACTGCTGG - Intergenic
1081672849 11:44951051-44951073 GCGCGTGCGCCCCCTGCAGGCGG - Intronic
1081804985 11:45885616-45885638 CCGCGCGCGCCCCCGGGACCCGG - Intergenic
1081807932 11:45900287-45900309 GCGGCCCCGCTCCCGGCCGCCGG - Exonic
1081812815 11:45922891-45922913 CCGAGGGCGCCCCCGGGCGCTGG + Exonic
1081812903 11:45923172-45923194 GTGCGCGCGGCCCTGGCGGCGGG + Intronic
1083572863 11:63769276-63769298 GCGGCCGCGCCCCCTCCCGCGGG + Intergenic
1083933379 11:65857923-65857945 GCGTGCGCGCCCGTGGGCGCCGG - Intronic
1083933653 11:65859431-65859453 TCTCGCCCGCCCCCAGCCGCGGG + Intronic
1084128697 11:67118209-67118231 GCGCGCCCACCGCCGGCCGGAGG - Intergenic
1084310276 11:68312687-68312709 GCGCGGGCCCGTCCGGCCGCCGG + Exonic
1084310330 11:68312864-68312886 GCGCCCGCGCACTTGGCCGCGGG - Intronic
1084515595 11:69636739-69636761 GAGCGCGCGCCGCCGGACCCTGG - Intergenic
1086697987 11:89865599-89865621 CCGCCCACGCCTCCGGCCGCCGG - Intergenic
1086708175 11:89978889-89978911 CCGCCCACGCCTCCGGCCGCCGG + Intergenic
1087141441 11:94768892-94768914 GCGCGCCCGCGCCCGCGCGCGGG + Intronic
1088223180 11:107591052-107591074 GCGCCCGCGCCCCCGGCTCCCGG + Intergenic
1088314929 11:108498114-108498136 ACGCGCGGGGACCCGGCCGCGGG + Intronic
1090285607 11:125496320-125496342 GCGGGCGCGCCCCCGGAGCCCGG - Intronic
1091262523 11:134245646-134245668 CCGCCCCCGCCCCCAGCCGCTGG - Exonic
1092843348 12:12562971-12562993 GCGCGCCCGCCCCCTACCCCCGG + Intergenic
1093633498 12:21437740-21437762 GCGCGCCCTCCCCCGACGGCAGG + Exonic
1094199179 12:27779965-27779987 GCCCGCGGGACCCCAGCCGCCGG - Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096116864 12:49060128-49060150 GCTCGCGCGGCCCCGGGCGCCGG - Intergenic
1096495458 12:52037164-52037186 GCGCGGGCGGCCGCGGGCGCGGG + Intronic
1096983627 12:55743152-55743174 GCCCGCGCGCCCGCCGCCCCCGG + Intergenic
1097989833 12:65823839-65823861 GTGCGCGCTCGCCCGCCCGCAGG + Intergenic
1099989551 12:89708552-89708574 GCCCCGCCGCCCCCGGCCGCGGG + Intronic
1100260652 12:92929334-92929356 GCGGGCCCGCCCGCGGCCGCCGG + Intergenic
1100309035 12:93377758-93377780 GTGCGCGCGGCCCCGCCCACCGG + Intergenic
1100315473 12:93441485-93441507 TCCCGCGCGCCCGCGGCCTCCGG + Intronic
1102247234 12:111363061-111363083 GCTCGCGCACCACCAGCCGCAGG + Exonic
1103309062 12:119989810-119989832 GCCCGCGCGCGCCAGGCTGCAGG - Intergenic
1103509729 12:121466607-121466629 GCGCGCCCGCCGCCCGCCGTGGG - Intronic
1103562689 12:121800537-121800559 GCGCGGGCGCCCGCAGCCGAGGG - Intronic
1103764615 12:123271491-123271513 GCGCGCCCGGCCCCGGCCCGGGG - Intronic
1104929195 12:132329355-132329377 GCGCGCCGGGCCACGGCCGCCGG + Intergenic
1105557358 13:21459409-21459431 GCCCGCCCGCCGCGGGCCGCGGG + Intergenic
1106422518 13:29595574-29595596 GCAGGCGCGCACGCGGCCGCGGG - Exonic
1106735928 13:32587172-32587194 GCGCGCGGGGACCCGGCGGCGGG - Intronic
1107468028 13:40666653-40666675 GCGCGCGCGCCGCCGCGGGCGGG - Intergenic
1110219649 13:73059483-73059505 GCACGCGCACCACCGCCCGCAGG + Exonic
1112041474 13:95552599-95552621 TCGCGTGCGCCCCCTGGCGCCGG + Intronic
1112216221 13:97434019-97434041 GCGGGCTCCGCCCCGGCCGCCGG + Intergenic
1112290904 13:98143399-98143421 GCCGCCGCGCCCTCGGCCGCCGG + Intronic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1113379302 13:109787266-109787288 GCTCGCGAACCCGCGGCCGCGGG - Intergenic
1113820364 13:113209012-113209034 GCGCGCGCGCCCCGAGGCCCTGG - Intronic
1116919842 14:50560764-50560786 GGGCGCGGGCTCCCGGCGGCGGG + Intronic
1117920727 14:60723468-60723490 GCGAGCCCGCGGCCGGCCGCTGG - Exonic
1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG + Intergenic
1120190589 14:81436282-81436304 GCGCGCTCGCCTCCTGCTGCGGG + Intronic
1122131292 14:99605451-99605473 GGGCGCGCGCTCCAGGCCGTGGG - Intergenic
1122162389 14:99793636-99793658 GCGGCCTCGCCCGCGGCCGCCGG - Intronic
1122226838 14:100285399-100285421 GCGCCGCCGCCGCCGGCCGCAGG + Intergenic
1122666679 14:103334702-103334724 GCGGGCGCGGGCCCGGGCGCCGG + Intronic
1122688986 14:103522733-103522755 GCGCGGACGCCCCCGGCCCCCGG + Intronic
1122736751 14:103847752-103847774 GCGTCCGCGCTCCCGGCGGCGGG + Intergenic
1122960980 14:105093528-105093550 GCGCGCGGGGCCCGGGGCGCGGG - Intergenic
1123004606 14:105315150-105315172 CCCCCCGCGCCCCCGCCCGCCGG + Exonic
1123441439 15:20294921-20294943 GCTCCCGCGCGCCCGGCCTCGGG - Intergenic
1123630713 15:22258136-22258158 CCCCGCGCGCGCCCGCCCGCCGG + Intergenic
1123787462 15:23687395-23687417 CCCCGCCCGCCCCCAGCCGCTGG - Intergenic
1126626059 15:50686759-50686781 GCGCCCGCGCCCGCCTCCGCCGG + Exonic
1126626079 15:50686822-50686844 GCGCGTGCGTCGCCGCCCGCGGG + Intergenic
1127342863 15:58065710-58065732 GCGAGCGCGCCCCCGGGCCGCGG - Exonic
1129189131 15:73927402-73927424 GCGCCCACGCCGCCGCCCGCGGG - Exonic
1129503207 15:76059798-76059820 GGGCGCGCGCGCGCGGCCGGCGG + Intergenic
1129503209 15:76059802-76059824 GCGCGCGCGCGGCCGGCGGGAGG + Intergenic
1130002613 15:80060055-80060077 GCGCGGGCGCCCGCGGCCGGGGG + Intronic
1130023631 15:80251901-80251923 TCGCGCGGGTCACCGGCCGCAGG - Intergenic
1130352952 15:83107607-83107629 GCGCGGGCGCCGCCGGAAGCTGG + Exonic
1130370957 15:83284795-83284817 GCGCGGTCGCCCCACGCCGCGGG + Intergenic
1131215193 15:90530226-90530248 GCGGGGGCGGCCACGGCCGCGGG + Intronic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1132398160 15:101489316-101489338 TCGCGCGCGCCGGAGGCCGCCGG + Intronic
1132594296 16:741182-741204 TCCCGCGCGCCCCAGGCCCCGGG + Intronic
1132683435 16:1152975-1152997 GCGCGCGCGTCTCGGGCCGGGGG + Intergenic
1133040866 16:3059201-3059223 GCGCCCGAGCCCCCGTCCGTGGG - Exonic
1133097685 16:3458321-3458343 GCGCCCGCGCCCCCGGCGCACGG + Intronic
1135495574 16:22948495-22948517 GCACGCGCGCCCCATGGCGCAGG + Intergenic
1136365469 16:29807212-29807234 GGGGGCGCGGCCTCGGCCGCGGG - Exonic
1136390596 16:29961995-29962017 GCGCATGCGGACCCGGCCGCGGG + Intronic
1136414698 16:30096106-30096128 GCGCGCGGGGCCCGGTCCGCCGG + Exonic
1136540600 16:30925769-30925791 GCGCTCCGGCCCCCGGCCCCCGG - Exonic
1136627799 16:31472457-31472479 GCCCGCGGGCGCCCGGGCGCGGG + Intronic
1137261154 16:46831054-46831076 CCGCCCGCGCGCCCGGCCCCCGG + Intronic
1137531738 16:49282330-49282352 GCCCTCGCGCCCGCGCCCGCTGG - Intergenic
1137988761 16:53131405-53131427 GCCCGCCCGACCCCGGCCCCGGG - Intronic
1138178718 16:54928827-54928849 CCGCGCGCGCCGCCCGCCGGGGG - Intergenic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1140033864 16:71358644-71358666 GCGCGCGCGCCCCCTTCTGGCGG + Intergenic
1140223108 16:73058187-73058209 GCGCCGCCGCCGCCGGCCGCCGG - Intronic
1140478821 16:75251727-75251749 GCGCCCGCGCCCCCGACAGGCGG - Intronic
1141132291 16:81444753-81444775 GCGCGGGCGCCCCGGGCTCCGGG + Intergenic
1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG + Exonic
1141972338 16:87492443-87492465 CCCCGCGCGCGCCCGCCCGCCGG - Intergenic
1142295382 16:89218094-89218116 GAGCGCGCGTCCCTCGCCGCCGG + Intronic
1142395407 16:89828773-89828795 GCGCGGGAGCCCGAGGCCGCGGG + Exonic
1142408783 16:89905697-89905719 GCGCTGGTGCCCCCAGCCGCTGG + Intronic
1142631460 17:1229046-1229068 GGGCGCGCAGCCCCCGCCGCTGG - Intergenic
1142664733 17:1456155-1456177 GCGCGCGCCCCTCCGGCCCCCGG + Exonic
1143174613 17:4948962-4948984 GCACACGCGCCGCCGCCCGCCGG - Exonic
1144128114 17:12221136-12221158 GCGCCCCCGCCCCCCGCCGTGGG + Intergenic
1144724498 17:17495031-17495053 CCGCGCGCGCTCCCGGCCTGGGG + Exonic
1145093977 17:20009214-20009236 GAGAGGGGGCCCCCGGCCGCCGG + Intergenic
1145962896 17:28897670-28897692 GCGAGCGGGCGGCCGGCCGCTGG - Exonic
1146214894 17:30971222-30971244 GCGCCCGCGACGCCCGCCGCTGG + Exonic
1146445292 17:32928087-32928109 GCGCCCCGGCCCCCGGCCCCCGG - Exonic
1147110439 17:38257359-38257381 GCGTGCGCGGCCCCGCCGGCCGG + Intergenic
1147168561 17:38605582-38605604 CCGCCCCCGCCCCCGGCCGAGGG + Intronic
1147184233 17:38705131-38705153 GCCCGCCCGCCGCCAGCCGCCGG - Intergenic
1147608309 17:41786447-41786469 CCCAGCGCGCCCCCTGCCGCCGG + Intronic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1147970838 17:44218693-44218715 GCGCGCGCGGCCACGGAAGCGGG + Intronic
1148122770 17:45222316-45222338 GGGCGCGCGTCCCCGCCCCCGGG + Intronic
1148156893 17:45429826-45429848 GCACGGGCGCCGCGGGCCGCAGG + Intronic
1148180632 17:45602190-45602212 GCGGCCCCGCTCCCGGCCGCCGG + Intergenic
1148206841 17:45784604-45784626 GCGCTGGCGCCCCCGGCCCCTGG + Intronic
1148268270 17:46243725-46243747 GCGGCCCCGCTCCCGGCCGCCGG - Intergenic
1148271728 17:46266919-46266941 GCGCGCGCGCGGCCGGGCGGCGG - Intergenic
1148419067 17:47531072-47531094 GCGTGCGCGGCCCCGCCGGCCGG - Exonic
1148807865 17:50273288-50273310 GCGCGGGTGCCCCCGGGAGCCGG - Intronic
1148818258 17:50346071-50346093 GCGAGCGCGCGCACGGGCGCGGG - Exonic
1148842587 17:50508470-50508492 GCGCACGCGCCCGCCGCCGGCGG - Exonic
1150423286 17:65056950-65056972 GCGCGCCCGGCCGCGGCTGCGGG - Intergenic
1151535483 17:74736871-74736893 GCGCCCGAGCCCCGGGCCGTGGG - Intronic
1151591393 17:75047102-75047124 CCGCGCGGGTCCCCGGGCGCTGG + Intronic
1151919145 17:77140867-77140889 GCGTGCGCGGCCGCGGCCGAGGG - Intronic
1152212485 17:79009773-79009795 GCGCGCGCTCGCCCCGCCTCTGG + Exonic
1152321575 17:79610936-79610958 CCTCGCGCGCCCCTTGCCGCTGG - Intergenic
1152357349 17:79813545-79813567 GCCCGCCCCCCTCCGGCCGCCGG - Intergenic
1152362722 17:79839902-79839924 GCCCGCGCGTCCCGGGGCGCTGG - Intergenic
1152628501 17:81399330-81399352 GCGCGCGGGGCCCCGGGTGCTGG + Intronic
1152719768 17:81917789-81917811 GCGCGGGCGCCCCCGGTTTCGGG - Intronic
1152748513 17:82051996-82052018 GCCCCCGCGCCCCCCGCCACTGG + Exonic
1152759158 17:82099117-82099139 GCGAGCGCACTCCAGGCCGCTGG + Intergenic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1152824961 17:82458838-82458860 GCGCGCGCCTCCCCGGCCCGCGG - Intronic
1153051921 18:908167-908189 GCGCGCGCCCCCTCGGCGGCCGG - Intronic
1153382251 18:4454000-4454022 CCGCGCTCGCCCCCGGCTGCAGG - Intronic
1153457231 18:5295278-5295300 CCGCCCCCGCCCCCGGCCGCGGG - Intronic
1153688350 18:7567769-7567791 GCGCGCCCACCCACCGCCGCCGG + Exonic
1153851878 18:9102653-9102675 GCGTGCGCGCTCCCGACCCCAGG - Exonic
1154274677 18:12948456-12948478 ACGTGCGCGCTCCCGCCCGCAGG + Intronic
1154447995 18:14450378-14450400 GCCCGCGCGGCCACGGGCGCGGG - Intergenic
1156452431 18:37274454-37274476 TCACGCGCCGCCCCGGCCGCAGG - Exonic
1157752933 18:50194719-50194741 GAGCGCGCCACCCCGGCCCCGGG + Intronic
1159911074 18:74147411-74147433 GTGCGCGCATCCCCGGCCACAGG + Intronic
1160025470 18:75211922-75211944 GGGCGCGCGGCCCGCGCCGCGGG + Intronic
1160163400 18:76491733-76491755 GCGCTCTCGCCCCCGGCCCCTGG + Intronic
1160706257 19:531620-531642 GCGCCTGCGCGCCCGGCCGCAGG - Intergenic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160789894 19:918495-918517 GCGTGGGCGCCACTGGCCGCGGG - Intronic
1160935607 19:1593059-1593081 GCGCACGCGCACCAGGCGGCCGG - Intergenic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161072718 19:2270591-2270613 GCACCCGCGCCCCCGGAAGCGGG - Intronic
1161203592 19:3029071-3029093 GCGCGCGCGCCCGGGGTCGTGGG + Exonic
1161313247 19:3606570-3606592 GCGCCCGGACCCCCGGGCGCGGG - Exonic
1161388098 19:4007637-4007659 GCGCGCGCTCCTCCCGCCGCCGG - Exonic
1161494961 19:4581600-4581622 GCGCGCGCTCTCCCCGCCCCCGG + Intergenic
1161628730 19:5340749-5340771 GCGCGCACGCCGCGAGCCGCTGG - Exonic
1161707235 19:5827846-5827868 GCGCACGCGCGCGCCGCCGCCGG - Exonic
1162100400 19:8335359-8335381 GCGCGCCCAGCCCCGGCCGCGGG - Exonic
1162100494 19:8335741-8335763 CTGCGTGCGCCCCCGGCGGCGGG + Exonic
1162435383 19:10654809-10654831 GTGCGCGCGCACCGGGCCCCCGG + Intronic
1162572126 19:11479962-11479984 GCGCGGGCGCCTCGGGCTGCGGG - Intronic
1162727055 19:12696126-12696148 GGGCGGGCGCCCCCGGCCCCCGG + Intronic
1162778792 19:12996040-12996062 GCGCGTGCGACCCTGGCCACCGG + Intronic
1162931956 19:13961967-13961989 GCGCCCCCGCCCTCCGCCGCTGG - Exonic
1163138637 19:15331944-15331966 CCCCGCCCGCCCCCGACCGCCGG + Intronic
1163453041 19:17390517-17390539 GTGCGCGCCGCGCCGGCCGCCGG + Intergenic
1163606778 19:18280221-18280243 GCGCTCGCCCCCCCGGGAGCAGG + Exonic
1163829319 19:19540301-19540323 GCGCGTGTGCCCGCGACCGCTGG + Exonic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1164594944 19:29526443-29526465 GCGCCCCCTCCCCTGGCCGCCGG - Intergenic
1164658572 19:29942447-29942469 GCGCCCGCGCGCCCGCCCTCAGG - Exonic
1164834757 19:31349901-31349923 GCGCCCCCGCCCCCGGCCCCAGG + Intergenic
1164992107 19:32692060-32692082 TCGCGCCCGCCGCCGGCCGAGGG + Exonic
1165040513 19:33064813-33064835 GCCCGCGGCCCCCCAGCCGCTGG - Exonic
1165345682 19:35247989-35248011 GCGCCCCCGCCCTCGGTCGCAGG + Intergenic
1166092517 19:40519528-40519550 GAGAGCGCGCCCCGGGCCGGCGG + Exonic
1166807671 19:45496876-45496898 GCGCCCGCGACCCCGGGCCCAGG - Exonic
1167104486 19:47422061-47422083 GCGCCCGCCCCTCCGCCCGCTGG + Intergenic
1167129153 19:47573082-47573104 GCGCGCGAGCCCCCGGGGGCGGG - Intergenic
1167643753 19:50695197-50695219 GGGCGCGCACCCCCTCCCGCGGG + Intronic
1168256098 19:55166187-55166209 GGGAGCGCGCCCTCTGCCGCTGG + Intronic
1168297329 19:55383802-55383824 GCGCCCCCGCCGCCCGCCGCCGG - Exonic
1168641395 19:58034084-58034106 GCGAGCGCGCCCAACGCCGCGGG - Exonic
925376228 2:3388116-3388138 CAGCGCGCGCCCCCAGCCTCCGG + Exonic
929033705 2:37671800-37671822 CCGCGCGCGCGCCCGGCCACCGG - Exonic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
931711000 2:64989165-64989187 GCCCGCGCCCCCGCGGCCTCGGG + Intronic
932562807 2:72887681-72887703 GCGCGAGCTCCCCCGGCCCAAGG + Exonic
932607674 2:73175833-73175855 GCGCCCGCCCCCGCCGCCGCGGG - Intergenic
932880108 2:75493310-75493332 GCTCGCGCTCCTCCAGCCGCTGG + Exonic
934746161 2:96761006-96761028 GGGCGCCCGCCCCCGCCCACCGG - Exonic
934846395 2:97663787-97663809 CCGCGTGCGCCCCCGGGGGCGGG + Intronic
935255718 2:101308265-101308287 GGGCGCGGCCCCTCGGCCGCCGG + Exonic
936713612 2:115161428-115161450 ACCCGCGCGCCCACGGCCGCCGG - Intronic
937044256 2:118842912-118842934 GCGGGCGCGGCCCCGGCCTGTGG + Exonic
937045003 2:118846593-118846615 GCGCCCGCGCCGGCGGCGGCTGG + Exonic
937951033 2:127388055-127388077 GCGGGCGCGCGCCCGGCCCAGGG + Intronic
938322087 2:130372431-130372453 CCGCGTGCGCCCCGGGTCGCTGG - Exonic
938339792 2:130527793-130527815 GCGCGGGCGCATCCGGGCGCAGG - Exonic
938350044 2:130592957-130592979 GCGCGGGCGCATCCGGGCGCAGG + Exonic
938583767 2:132670113-132670135 GCGCTCGGGCTCCCGGCTGCGGG + Exonic
942248102 2:174025751-174025773 GCGCACGCGGCCCCGGCAGCTGG - Intergenic
942450987 2:176107908-176107930 GCGCCCGGGCCCCCGTTCGCCGG + Exonic
944154014 2:196592747-196592769 GAGCGCGCGGCCCTCGCCGCAGG - Intronic
944495862 2:200306861-200306883 GCGACCGCGCCCCCGGGCCCCGG + Intronic
944515677 2:200509867-200509889 ACGCGCGCGCCCCGGGCTGCAGG - Exonic
944675947 2:202034245-202034267 GCGCGCACGCCCCCCGCGCCTGG - Intergenic
945225858 2:207530424-207530446 CCGCACACACCCCCGGCCGCCGG - Intronic
946219960 2:218217547-218217569 GAGCGCGCGCCCGGGGCCGGGGG + Intronic
946322241 2:218960832-218960854 GCGGGCGCGCCCCCGCTCGGTGG - Exonic
946373566 2:219294948-219294970 GCGCGGGCGCCCCCGCCTGGAGG - Intronic
947745061 2:232503185-232503207 GCGCTCCCGCCCCCGCCCGCGGG + Intergenic
948116024 2:235494618-235494640 GCCCGCGGGCCCCGGGGCGCGGG + Exonic
948823244 2:240560843-240560865 GCGCGCGCGGGCCGGGCTGCTGG - Exonic
948953991 2:241272897-241272919 GCGCCCGCCCGCCCCGCCGCTGG + Intronic
949018175 2:241725283-241725305 GCGCGCCCGCCCACGTCCGCCGG - Exonic
1171974847 20:31587901-31587923 GCGCCCTCGCCCCCGCCCGCCGG + Intergenic
1173454029 20:43189575-43189597 GCGCGCGGGCCCCCAGCCGCGGG - Intronic
1174287687 20:49483991-49484013 GCCCGGGCGCCCCCGCCCGTGGG + Intergenic
1174611427 20:51801458-51801480 GCGCCCGCCACCCCGGCCACTGG + Intronic
1176005598 20:62860993-62861015 CCCCGCCAGCCCCCGGCCGCCGG + Intronic
1176194575 20:63831304-63831326 GCGCGCGCGCGCCCCGCCCGCGG + Intergenic
1176221029 20:63969524-63969546 CCGCGCCCGCTCCCGGCCCCAGG - Intronic
1176380613 21:6110763-6110785 GCGGGCGCGCCCTCGGCGGTGGG + Intergenic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1176547887 21:8209265-8209287 GCGCGCGCCCCGGCGCCCGCGGG - Intergenic
1176547891 21:8209278-8209300 GGGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1178584849 21:33863363-33863385 CCGTGCCCGGCCCCGGCCGCTGG - Intronic
1178708196 21:34890784-34890806 GCGCGCGCCCGCCCGCCCGCAGG + Intronic
1179213735 21:39349118-39349140 CCCCCCGCGTCCCCGGCCGCGGG + Exonic
1179511960 21:41879211-41879233 GCGTGCGCCCCGCCGGCCCCGGG - Intronic
1179605550 21:42513566-42513588 GCGCGCTCCCCACCGGCCTCCGG - Intronic
1179742859 21:43427477-43427499 GCGGGCGCGCCCTCGGCGGTGGG - Intergenic
1180177606 21:46098128-46098150 GCGCCCGCGCCTCGGGCCGTCGG + Exonic
1181437731 22:22920234-22920256 GAGCGGTCGCCCCAGGCCGCTGG - Intergenic
1182355345 22:29720245-29720267 GCCCCCGCGCCCCGGGCCGCCGG - Exonic
1182532273 22:30969496-30969518 GCGCGAGCGCCAACGGCCACCGG - Intergenic
1182804457 22:33058394-33058416 GCGCGAGCGCCCCCGCCCGGCGG + Intergenic
1183650856 22:39152548-39152570 GCGCGTGCGCGCCCGGACGAGGG - Exonic
1183939624 22:41286020-41286042 GAGCGCGCGCCTCCGCCCTCTGG + Intronic
1184465953 22:44668956-44668978 GCGCGCGCGACGCCGACTGCGGG + Intronic
1184523225 22:45007780-45007802 GGCCGCGCGCCCCCGCCCCCTGG - Intronic
1184593820 22:45502726-45502748 GGGCGCGCGCCCACGGCTGGGGG - Intronic
1184593825 22:45502737-45502759 GGGCGCGCGCCCCTCGCAGCCGG + Intronic
1185255202 22:49827757-49827779 GCGCCCGCGCCCGCGCCCGCCGG - Intergenic
1185288044 22:50011054-50011076 GCGCGGGAGCCCCTGCCCGCGGG - Intronic
1185351750 22:50343259-50343281 GCGCGCACGCTCGCGGCCGGGGG - Intergenic
1185418051 22:50720726-50720748 GAGCGCGCGGCCCTGGCCGTGGG + Intergenic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
949559478 3:5188326-5188348 GGGCGCGCGGCCCCGGGCGGCGG - Intronic
949987811 3:9553640-9553662 GCGCGCGAGGCTGCGGCCGCGGG + Intronic
950282383 3:11719420-11719442 GCGGGCGCGCCCAGAGCCGCCGG - Intronic
950282447 3:11719603-11719625 GCTCCCGCGCTCCCGTCCGCCGG - Intronic
950683974 3:14603194-14603216 GCGCGCGCTTTCCCGGGCGCCGG + Intergenic
953623918 3:44555111-44555133 GCGCGCGCGTCCCCGCACCCGGG - Intergenic
954228633 3:49199471-49199493 GCACGCGCGGCCCCGCCCCCAGG - Intronic
954778848 3:53045286-53045308 GCGCGCCCGGCCCCAGCTGCGGG + Intronic
954912492 3:54121729-54121751 GCGCGCCCGACCCAGGCCCCGGG - Intergenic
956061867 3:65356537-65356559 GCGCACGCTCCCCCGAGCGCAGG - Exonic
956061870 3:65356552-65356574 GCGTGCGCGCCTCCGGTCGGTGG + Exonic
956129271 3:66038894-66038916 GCGCGCGCGTCTCCTGTCGCCGG - Intergenic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
957947989 3:87089099-87089121 GCGCCCGCGCCCCCGTACTCCGG - Intergenic
961545302 3:127629152-127629174 GCCCGCGCGGCCCCTGACGCGGG + Intergenic
961858277 3:129893762-129893784 GCGCGTGCGCCGCCGGCCGGGGG - Intergenic
962793954 3:138834914-138834936 GCGCGCGCGCACACGGGCGCGGG - Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
964622590 3:158732220-158732242 CCGCGCGCGCCGCCTGCTGCAGG + Exonic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
968081552 3:195849852-195849874 CTGCGCGCGCCCCCTGCCGGCGG - Intergenic
968090411 3:195895476-195895498 GGGCGCGACCACCCGGCCGCCGG - Exonic
968090576 3:195895985-195896007 GCGCGCGGGGAACCGGCCGCGGG - Intronic
968114966 3:196082207-196082229 GCGCGCGCATCCCCGCCCCCCGG - Intergenic
968514951 4:1011966-1011988 GCGCGCGCGGCCGCGACCCCAGG + Intronic
968556570 4:1248881-1248903 GCGCGCGCGTTTCCGGCCGCGGG - Intronic
969379140 4:6782883-6782905 GCCCGCGCCCACCCGGCCGAGGG - Intronic
969716884 4:8872034-8872056 GGGCGGGCGGCCCCGGGCGCAGG + Intergenic
972686779 4:41360343-41360365 GCGCCCGCTCCCCCGGGCCCGGG + Intronic
973754911 4:54064806-54064828 GGGCGCGCGCTCCCGCCGGCGGG + Intronic
975779057 4:77819920-77819942 GCGCCGGCGGCCGCGGCCGCGGG - Intergenic
976897400 4:90128236-90128258 GCGCTGGCGCCCCGGGCTGCGGG + Intronic
977694341 4:99949927-99949949 GGCCGCGCGCCTCCGCCCGCCGG + Intronic
980130460 4:128811953-128811975 GCGCGCCCGCCCCAGCCCGAAGG + Intronic
981474977 4:145179701-145179723 GCACGCGCAGCCCCGGCCGTGGG + Intronic
984973363 4:185209743-185209765 GCGCGGGCTCCCCCTGCCTCCGG + Intronic
985129023 4:186723620-186723642 ACGCTCTCGCCCCCGCCCGCCGG + Intronic
985727452 5:1523676-1523698 GGGCGCGCGGCCCCGGGAGCCGG - Intronic
985895486 5:2748314-2748336 TCCCGGGCGCCGCCGGCCGCGGG + Intronic
986330724 5:6714263-6714285 CGCCGCGCGCCCTCGGCCGCGGG - Intergenic
987379930 5:17275607-17275629 GAGAGCGCGGCCCCTGCCGCCGG + Exonic
989638106 5:43557153-43557175 GCGGGCGCGTCCCGGGCCTCCGG - Intronic
990175992 5:53109546-53109568 GCGCCCCCGCCCCCGCCCCCGGG - Exonic
990753223 5:59039886-59039908 GCGGGCGCGACCCCGGACGGCGG - Intronic
991371557 5:65925555-65925577 GCACGCGAACCCACGGCCGCCGG + Intergenic
991391067 5:66144204-66144226 GCGCGCGCAGCCCCGGGAGCAGG + Exonic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
992732788 5:79689762-79689784 GCTCGCCCGCCCCCGGCGCCGGG + Intergenic
995650091 5:114361103-114361125 GGGATGGCGCCCCCGGCCGCCGG - Exonic
997583941 5:135033907-135033929 GCGCGCCCAGCCCCGGCCCCTGG - Exonic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1000345817 5:160312551-160312573 GCTCGCAGGCTCCCGGCCGCCGG + Exonic
1002180082 5:177426790-177426812 TCGCGCGCGATCCCGGCCGGCGG + Intronic
1002184201 5:177446741-177446763 GCGTGCGCGCGCGCGGCAGCCGG - Intronic
1002488762 5:179559104-179559126 GCGCGCGCGCGCCCGGGTGAGGG + Intronic
1002888282 6:1313797-1313819 AGGTGCGCGCCGCCGGCCGCCGG - Exonic
1003049469 6:2766240-2766262 CCGCCCGCACCCCCGGGCGCTGG + Exonic
1004561803 6:16759967-16759989 GCGCGCGCGCGCCGGGCGGGGGG - Intronic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1007739652 6:44002830-44002852 GCGCGCGCCCCGTCGGCGGCGGG - Exonic
1010141866 6:72622079-72622101 GCGGGCGCCCCGTCGGCCGCCGG + Exonic
1011044403 6:83065926-83065948 GCGCGCCCCGCCCCGGCCTCCGG - Intergenic
1011075191 6:83431081-83431103 CCACGCCCGCCCCCAGCCGCTGG - Intergenic
1011277438 6:85643758-85643780 GCGCGCCCGGCCCCCGCCCCCGG + Intronic
1011416282 6:87122857-87122879 GTGCGCGCCCCCCGGGCCTCGGG + Intergenic
1011640473 6:89412336-89412358 GCGCGCGCTCGCCCGGCCGCGGG + Intergenic
1013099517 6:106974952-106974974 GGGCGGGCGCCGCCGGCTGCTGG + Intronic
1013366300 6:109440757-109440779 GCGCGGGCGGCCGCGACCGCCGG + Exonic
1013459002 6:110357954-110357976 GCGCGGGCGCCCCCGCCGGAAGG - Exonic
1013575934 6:111483401-111483423 GCGCGGGCGCTGCCGGCCGCCGG - Intronic
1013619281 6:111872872-111872894 GCGCACGCCGCCCCCGCCGCAGG - Intronic
1014798252 6:125749456-125749478 GCGAGCGCGGCCCCGCCCCCTGG + Intronic
1016340893 6:143060762-143060784 GGGCGCGCGCCCCCGGGGACTGG - Intronic
1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG + Exonic
1017497637 6:154995561-154995583 CCGCGCGCCGCCCCGCCCGCAGG - Intronic
1017913944 6:158818370-158818392 GGGCGCGCGCCCCCGCTCTCGGG - Intronic
1019473381 7:1232931-1232953 CCGCCCGCGCCTCCCGCCGCTGG + Exonic
1020066219 7:5190374-5190396 GCGCGCGCGCCCTCCCCGGCCGG + Exonic
1020105719 7:5421405-5421427 GCCTGTGCGCCCCGGGCCGCGGG - Exonic
1020125536 7:5530844-5530866 CGGCGCGCGCCCCCAGCCCCCGG - Intronic
1021600206 7:22356932-22356954 GCGCTCGGGCTCCCGGGCGCTGG + Intronic
1021992508 7:26152138-26152160 GGGCGCGGGCCCCGGGCGGCAGG + Intergenic
1021998338 7:26201638-26201660 GCGGGCGCGCGCCCGGCGGGGGG - Intronic
1022230687 7:28409836-28409858 GCGCGCGAGTCCCCTGACGCGGG + Intronic
1022528241 7:31052102-31052124 GCGCCCCCGACCCCCGCCGCTGG + Intergenic
1022923288 7:35037252-35037274 GAGCGCGCGCCCCTGTCCCCGGG - Intronic
1023881813 7:44325180-44325202 ACCCGCGAGCCCCCGGCCCCGGG - Intronic
1023955730 7:44885383-44885405 GCGCTCGCGCCCCCGCCCTCCGG + Intergenic
1025033059 7:55572618-55572640 GTGCGCGCGCCCCGGGCGGGAGG + Intronic
1026360501 7:69598231-69598253 GCCCCCGCGGCCCCGGCCGGCGG - Intergenic
1026665311 7:72336324-72336346 GGCTGCGCGCCCCCGCCCGCAGG - Intronic
1026909479 7:74083914-74083936 GCGAGCTCGCCCACCGCCGCCGG - Intronic
1027654935 7:80919065-80919087 GAGCGCTCGCCCCCGGCCTCCGG - Exonic
1029640435 7:101816469-101816491 GCGCGCACCCCGCGGGCCGCCGG - Intronic
1031051863 7:116953402-116953424 GAGCCCGCGTCCCCGGCGGCGGG + Exonic
1031966550 7:128031651-128031673 CCGCGCGCTCCTCCGGCCGGCGG - Intronic
1032011754 7:128351862-128351884 GCGCGCACGGCCCCGGTGGCGGG - Exonic
1032151647 7:129434491-129434513 GCGGGCGGGCCCCCGGTCCCAGG - Exonic
1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG + Intergenic
1033899336 7:146116415-146116437 GCGAGCGCTCCCTCCGCCGCCGG - Exonic
1034147048 7:148883546-148883568 TCGCGCACGCCCCCGGTCCCGGG - Intronic
1034344654 7:150379075-150379097 GCGCGCTAGCCGCCGGCCGCGGG - Intronic
1034418705 7:150978124-150978146 GAGCGCGAGCCGCCCGCCGCCGG + Exonic
1034618051 7:152435993-152436015 GCGCGCGCACCTCCGCGCGCAGG + Exonic
1036910381 8:12754072-12754094 CCGCGCGGGCGCCCGGCCCCGGG - Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1038017760 8:23529444-23529466 GCGTGCCCGGCCCCGGCTGCTGG + Intronic
1038267122 8:26046030-26046052 GCTCGCGCCCGCCCGCCCGCGGG - Intergenic
1039493655 8:37965627-37965649 GCGCGCGGGCCGCCGGCCGCAGG + Exonic
1039903129 8:41767187-41767209 GCGCGCGCACCCGCACCCGCCGG + Intronic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042399662 8:68331119-68331141 GCTGGCTCGGCCCCGGCCGCGGG - Exonic
1043388314 8:79768523-79768545 CAGCGCGCGCCTCCAGCCGCCGG - Intergenic
1043502973 8:80874375-80874397 GCGCGCGCGGGCTCGGCCGCCGG - Intronic
1045459407 8:102412779-102412801 GCCGCCGCGCCCCCGCCCGCCGG - Exonic
1047319810 8:123768664-123768686 GCGGTGGCGGCCCCGGCCGCCGG + Exonic
1048472060 8:134712730-134712752 GTGCGCCGGCCGCCGGCCGCCGG - Intronic
1048554035 8:135457774-135457796 CCGCCCGCGCCCCCAGCGGCGGG - Exonic
1049194512 8:141308102-141308124 GCCCCCGCGGCCCCGGCCGGAGG - Intronic
1049654799 8:143792770-143792792 GTGCGCGTGCCCCAGGCCGAGGG - Exonic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1049798364 8:144506632-144506654 GAGCGCGCTCCACCGCCCGCGGG - Exonic
1053003437 9:34590125-34590147 TCACGCGCAGCCCCGGCCGCGGG + Intronic
1054798625 9:69325370-69325392 GCGCCCGGGCCCCCGGCCTGCGG - Intronic
1054906624 9:70419072-70419094 GAGCGCCCGCCCCCGAGCGCGGG - Intergenic
1056475052 9:86945720-86945742 GCCCTCGCGCCCCCCGCCGTTGG - Exonic
1057054532 9:91950291-91950313 GCGCCGGCGCCCCCTGCCGGGGG + Intergenic
1057228889 9:93306897-93306919 GCCCACGCCCGCCCGGCCGCGGG - Intronic
1057432130 9:95004645-95004667 GGGCCCGCGCCGCCCGCCGCAGG - Intronic
1057489562 9:95510851-95510873 GCGCGCGCGCGCCCGGCTCCCGG + Intronic
1058687231 9:107489607-107489629 GCGCGCGCGGCCATGGGCGCGGG + Exonic
1058908186 9:109498148-109498170 CCGAGCGCGACCCCGGCCCCCGG + Intronic
1059191839 9:112333847-112333869 GCGCGCGCGCGCCGGGCCGAGGG - Intergenic
1059191852 9:112333885-112333907 GCGCGCGCTCCCGCGAACGCAGG - Intergenic
1059414392 9:114154277-114154299 GCCCCCGCGCCCACGGCTGCGGG + Intergenic
1059414731 9:114155800-114155822 GCTCGGGCGCCCCTGGGCGCGGG + Exonic
1060147942 9:121268227-121268249 AGGCGCGCGGCCCCGGCCCCGGG + Intronic
1060700940 9:125748017-125748039 GCGCCGGCTCCCGCGGCCGCGGG + Intronic
1060770263 9:126327079-126327101 GGGCGCGGGCCCCCGGCCGAGGG + Intronic
1061128029 9:128689154-128689176 GCGCGAGCCTCCCCGGCCGGAGG + Intronic
1061348090 9:130042878-130042900 GCGCCCCCTCCCCAGGCCGCGGG + Intronic
1061382379 9:130266143-130266165 GCCCCCGCACCCCCGCCCGCCGG + Intergenic
1061700334 9:132410553-132410575 GCGCTCGGACCCCGGGCCGCGGG - Intronic
1062022664 9:134326692-134326714 GCCCGCCGGCCCCCGGCCCCCGG - Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062349597 9:136132541-136132563 GGGCGCGCACCCCTGGCTGCAGG - Intergenic
1062383809 9:136300248-136300270 GAGCTCGCGCCCCTGGCCGTGGG + Exonic
1062499628 9:136846800-136846822 GCGCGCGAGCTGGCGGCCGCTGG + Exonic
1062517642 9:136944315-136944337 GGGCGCCCGCTGCCGGCCGCAGG - Intronic
1062543335 9:137051156-137051178 GCGTGGGCGCCCTCGGCCCCTGG - Intronic
1062596546 9:137302337-137302359 ACGCGCGCGCCGGCGGCCCCGGG + Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1188242667 X:27809515-27809537 GCCCGCCCCCCCCCCGCCGCCGG + Intronic
1189322570 X:40095755-40095777 GGGCGCGCGCCGCCGGCGTCTGG - Intronic
1191184070 X:57591980-57592002 GCGATCCCGCCCCCTGCCGCGGG - Exonic
1191213320 X:57910467-57910489 GCGATCCCGCCCCCTGCCGCGGG + Exonic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1195954887 X:110318169-110318191 GCGCGCGCCCCGCCAGCCTCTGG - Exonic
1196734965 X:118975144-118975166 GCGCCGGCGCCCCCGGACGAGGG + Exonic
1196918264 X:120561169-120561191 GCGCGAGCTCCCCCGCCCCCCGG - Intronic
1198276406 X:135098712-135098734 TAGCGCGCCCCGCCGGCCGCCGG + Intergenic
1198767163 X:140091576-140091598 CCGCGCGCCCGCCCGCCCGCAGG + Intergenic
1200092965 X:153644332-153644354 GCGCGCTCGCTGCCCGCCGCAGG - Intronic
1200128909 X:153830643-153830665 CCGCGCGCCTCCCCGCCCGCGGG + Intergenic
1200128999 X:153830913-153830935 GCGAGCGCGCCCACGGCGGCGGG + Intergenic
1200146369 X:153928280-153928302 GCGCGCGAGCCCAGTGCCGCCGG + Intronic
1200173779 X:154097710-154097732 GCGCGCGCGCCGCCGACGCCGGG + Exonic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic